Entry information : EsilCP01(Esi_0772_0002 / Esi_0612_0005 / Esi_0611_0008)
Entry ID 8386
Creation 2011-05-17 (Christophe Dunand)
Last sequence changes 2011-05-17 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2021-01-29 (Christophe Dunand)
Peroxidase information: EsilCP01(Esi_0772_0002 / Esi_0612_0005 / Esi_0611_0008)
Name EsilCP01(Esi_0772_0002 / Esi_0612_0005 / Esi_0611_0008)
Class Catalase peroxidase    [Orthogroup: CP002]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EsilCP01
start..stop
S start..stop
EsilCP02 1250 0 1..698 1..697
EsilCP05 1105 0 1..708 1..664
EsilCP03 732 0 1..508 63..565
EsilCP03 80 0.000000000000001 457..545 148..240
EsilCP03 48 0.000007 576..608 557..590
EsilCP04 716 0 1..501 1..497
EsilCP04 74 0.00000000000005 457..549 87..183
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11638..11730 93 N° 2 10309..10882 574 N° 3 9631..9759 129 N° 4 8752..9083 332
N° 5 8031..8411 381 N° 6 7030..7773 744  
complement(join(7030..7773,8031..8411,8752..9083,9631..9759,10309..10882,11638.. 11730))


exon

Literature and cross-references EsilCP01(Esi_0772_0002 / Esi_0612_0005 / Esi_0611_0008)
Protein ref. UniProtKB:   D7G523 [Incorrect prediction]   D7G526 [Incorrect prediction]   D7G6M6 [Incorrect prediction]
DNA ref. GenBank:   CABU01011240.1 (11730..7033)
Protein sequence: EsilCP01(Esi_0772_0002 / Esi_0612_0005 / Esi_0611_0008)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   750 (728)
PWM (Da):   %s   80233.75 (78138.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   3.79 (3.76) Peptide Signal:   %s   cut: 23 range:23-750
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRTCKLGVLAALALAAVPASASCPFLGGQKGSQPDLGTGVDRALRSYDDSYYSGSGADFSRETYEALQADITAVFTDSQDFWPADFGNYAPLMIRLAWHCNGNYRQSDGRGGCDGGRIRFNPERSWADNTNLDKALTLLQPIKLKYGDAVSWGDLITLTGNEAIRSMGGPVLGFCAGRLDDASGFDSLELGPSPEQEAVAPCAVNGTCEFPLGTSTVGLIYVNPEGPLGVPDPAGSAADIRDVFGRMGMNDSETVALIGGGHAFGKFHGACATGPGPDPTDAPEAPWPGTCGDPDSPTFGRAENTFTSGFEGQWTVEPLVWDNAYFKDLLEYDWVMTESPADQVQWFPVLKEGATETEDEIPDIIMLTSDIALLDEEYLALVELFASDLSYLDTAFAAAWYKLTSRDMGQFQRCVGTDVAPPQDFQLPLPEAPADLPDTDGAKSAIMSILSSDPSYPALFVTLAWQCASTYRSTDFLGGCNGARIRFSPERDWASNQGLDQVLSLLEPVQDEYPDVSYADLIVLAGNLALDLDDLPFCAGRVDVAEGDELISVLEPREYDDVIVGVRDRMKIRGLSVAQMVALAGRPRSASHMVTLGFSGSYTDEENPPLSNAFYVTLLTETWEEVPGSNGQEFQAVGRSGIYVLATDLALVWDPEFKAQTVMYAEDNEQFLKEFASAWTAVMIADRFDGPTGNVCHDASDSDDSSDDSSSDSDSSDSSDSSDSSDSSDSSDSSSSSSSSSDSDSDDH*

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Also found in CABU01012416.1 and CABU01011244.1. FN648833.1 contains Esi_0612_0001, Esi_0612_0004, Esi_0612_0015 and Esi_0612_0007 which contain part of CP1 (duplication of assemby errors. No EST. Incorrect splicing prediction confirmed with the ESTs of EsilCP02.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTCGCACGTGCAAACTCGGGGTCTTGGCCGCGCTCGCGTTGGCTGCAGTGCCCGCATCCGCCAGCTGCCCTTTCCTCGGTGGCCAGAAGGTGAGCGCATGCTGCATGTACTGCTGT
ATCGGCCAAAGTTACAACATGTCCCAGCCAACTGCTCGTCCGTCCCGGGTGAGATTTTAGGTTCGTTCGTATTGTATGTTATTTTCAATATTTTCCTTTCGTTGTGTCCCTGCCCTCCCC
ACCCCCGCGATGTCGTTTATATAGCCTTCAGTGTGTCTTGTCTAGACTACTCTTCTTTTCCCAGAACGCGAAACGAACTCCCATGACCGTACATGGATTGATGTAAACAACCCCGAAATG
ATATACGGCGTTCGCGTACACACCACAAACAGGAACCGACTGGTGGTGTAACTTCAAGTCTAGACTTTTCATTCCGCGAAAAAGTAATGCCGAATTACGAAACGCAGGGAGGGCCCGTAG
AGGGAAATCCACTACTGTAATAACTCGCACACAGCCACATACCATAAAGAAAGGTGAAAGTACTACTATACCGTACGGATCCACGCGGAAGCTGAGGGGAAGACAAATTCCGCACGGAGT
ACAAGTGTCATGAGGCTGAGCTTCATCCGTCATCCTTAAACCGGGAGATAATTTTCCCGTGCTTCCCGTACGTTGATATATCTACATTTTCCCAAGCACAGAGTTTCCTTCGATCCGTGG
GCCAGATCACACCGTATACCGTGTTGTACCGAGTGTGTGTCAAGCTGCCTGATGAAATAGTGCGATTAGCAATACGCGCACCTCCTCCTAACCACGACCACCACCCCCGTGCTCCCGCCC
GACGGCAGGGCTCGCAACCCGACCTAGGCACCGGCGTGGACCGTGCCCTGAGGTCCTACGATGACAGCTACTACTCCGGAAGCGGCGCGGACTTCTCGCGGGAGACCTACGAAGCACTCC
AGGCCGACATCACGGCCGTGTTCACGGACTCGCAGGACTTCTGGCCGGCGGACTTCGGCAACTACGCGCCGCTGATGATCCGCCTCGCGTGGCACTGCAACGGCAACTACCGCCAGTCGG
ACGGCCGCGGCGGGTGCGACGGCGGCCGGATCCGCTTCAACCCGGAGCGCAGCTGGGCCGACAACACCAACCTCGACAAGGCGCTGACCCTGCTGCAGCCCATCAAGCTCAAGTACGGCG
ACGCCGTCTCGTGGGGGGACCTCATCACCCTCACGGGTAACGAGGCGATCAGGTCGATGGGGGGCCCCGTGCTTGGGTTCTGCGCCGGGAGGCTGGACGACGCCTCCGGGTTCGACAGCC
TCGAGCTCGGACCCTCACCCGAGCAGGAGGCCGTCGCTCCCTGCGCCGTCAACGGGACGTGCGAGTTCCCCCTCGGCACCAGCACGGTGGGGTTGATCTACG
GTGAGTAAAACGGCGGTG
TTTGTTTTGTCACTGGGGCAATGCGTAGTGATGAGGGTGGGTCTTGTCACCGCCGTGTTCCATCGAAAATCGAAAATACACAGACAGGTAGGTAGCTCTCCTCTCCTTTGGTCTTGTTCC
CCCTGACATGGAGAAGTGAGTAAAACTGGCGCTACATAGTTTCCCGCCAGACAAAATGCGTAGTCGATAGATGTAGGTAGCTCACCTTTGGTTTTGCACCCCATGACGACGACGCCACAC
GCGCGGACGTAGGCGTTGGAGCTTGGACCCCCGCTCGGCGACATGTACCTCGTGATTTCGGCAGCGGTTTGCCAGTGCCTGCATGCCGGAGTACCTAGTCATCTACGCGCCACTGCCCCT
CCCTGTGTTCCTCTCGAAGGCTCACGCTCATTTTCTCTGCACCGCCCCTGCTCGGGGTATTCTTCTAGTATTTTGATGTAATCAACCAATTATTTACCTTGAGTGTTCCATCAACAGAAC
AACCACTGCTGTTGACGGCGAAACTCTCCTACCTCCCCCATACATCCCCAGTGAACCCGGAGGGGCCCCTCGGTGTTCCCGACCCCGCCGGCAGCGCTGCCGATATCCGTGACGTGTTTG
GGCGCATGGGCATGAACGACAGCGAGACCGTGGCTCTTATCGGCGGAGGGCACGCGTTCG
GTGAGCTTGAGCGAGTCAGAGAGTCGGCAACAACGTGCTATAATAATAGTTTGTTTATTA
CTTGTACGCATCGATCCGAAACGCCATCATTGGTACACGTCGTGCGGAGCGGAGCGTCTTGGCATCTGAATTGGTTGTGTTCTCATGCGCACCACACAGGCAGAAGTACAGCACGGGTTG
TTGCTGACGAAAAGGATCTCTACAATGTCGGTCAGCGCGTGCCCGTGCCCATGCTGTTTCACATCTAGCTGTAGGCTAACCCCTCCAGAACGCTTGCACATCATCGTGGCACAATTATCC
ATCCTCTCTTGCAACCGCGCAACCCAATCTTCCGCACCACGTCCCGGTTGTCGATGCCGCTGCCCAAACCTACCCACGGGATCACCGCCACCATTTCAGGTGGTCTGCTCTTCATGTGGT
CTTCGGAGCGATTTGTCCTCCGCTCTACGTTGCTTCCTTCGCTGTCTCTGTGCTAGATCGCTGATTACCCCTCCCCCCCCCCCCCGCGCCATCGGGGTATAACGTGCGGCGCGTGCTTCC
CAACCAGGAAAATTCCACGGCGCGTGCGCCACCGGCCCCGGCCCCGACCCCACCGACGCCCCCGAAGCCCCCTGGCCGGGAACGTGCGGCGACCCCGACTCCCCGACCTTCGGCCGCGCG
GAGAACACCTTCACGAGCGGGTTCGAGGGCCAGTGGACGGTGGAGCCCCTGGTGTGGGACAACGCGTACTTCAAGGACCTCCTCGAGTACGACTGGGTGATGACGGAGAGTCCGGCGGAC
CAGGTCCAGTGGTTCCCGGTCCTGAAGGAGGGGGCCACGGAGACGGAGGACGAGATCCCCGACATCATCATGCTCACCAGCGACATCGCCTTGTTGTAT
GTGAGAGAAAGCGAAACCGTC
ATCTTTTCTCCTCCGCCTAGGATTGAACCCTCCACCAACCATATATGCCGAACGTGTGTGTCCAAATTTTCGGGGTAGGTCGTCGTCCTTCGGCGTAGGTACCGAGTGACGTTTGACATG
ATATCAGTCTTTTATGTGACGCCGTTGGCATGACACGTGCCTATCCGACACGTAGGGATTCCAGATTTGTGTCCCACGTTGACAACTATTTGATAGCCACAACACACGTCAGAAAAATGC
CAGCAATGGTCGAAACCTCGCACACGCATACACCGGTCTCATTCCTTAAAATCCTCTGCGCTGACCGCTTGTTGTGCAGGACGAGGAATACCTCGCCCTCGTGGAACTCTTCGCCAGCGA
CCTGTCCTACCTCGACACCGCCTTCGCCGCGGCTTGGTACAAGCTCACCTCGCGGGACATGGGCCAGTTCCAGCGCTGCGTGGGCACCGACGTGGCGCCGCCCCAAGACTTCCAGCTGCC
TCTCCCGGAGGCGCCGGCCGACCTCCCCGACACCGACGGGGCCAAGTCGGCGATCATGAGCATCCTGTCCAGCGATCCGTCCTACCCCGCCCTGTTCGTCACGCTGGCTTGGCAGTGCGC
GTCCACGTACCGCTCCACGGACTTCCTGGGCGGCTGCAACGGGGCGAGGATCCGCTTCTCTCCCGAGAGGGACTGGGCCAGCAACCAGGGTCTCGACCAG
GTGTGTGGGTGTCGCGCCTA
CGGTACGATGTCGCTCTTTAGGCGACGCTTGCAGGGTTGTGTTTCTTGTGCAAGTTTCGCTTAGGACACCTTTTTCCGCGTCGTTTGTGCTACTACGATCTCGCAGCCCGACTTCCTAAG
CCGGTCGCTTTTGTTTTTTGTTCCCTAGTGATTTCGCCTATGCTGTGCGTACTATCTCCTGCTATTGCCCCGTCCAATACCAAACGCCGTTGCTGTACACGAAACGAACTACTGTAGGTG
CTGAGCCTGCTCGAGCCCGTGCAAGACGAGTACCCGGACGTGTCCTACGCCGACCTGATCGTGCTCGCGGGAAACCTCGCCCTCGACCTCGACGACCTCCCGTTCTGCGCCGGCCGCGTC
GACGTCGCCGAGGGCGACGAGCTCATCTCGGTCCTCGAGCCCCGCGAGTACGACGACGTCATCGTGGGCGTGCGCGACCGCATGAAGATCAGGGGCCTGTCGGTCGCGCAGATGGTGGCC
CTCGCCGGCCGCCCCCGCAGCGCCTCGCACATGGTCACCCTCGGCTTCAGCGGGTCCTACACGGACGAAGAGAACCCGCCCCTCTCGAACGCCTTCTACGTCACCCTCCTCACCGAGACC
TGGGAAGAGGTGCCGGGATCGAACGGGCAGGAGTTCCAGGCCGTCGGCAGGTCCGGCATTTACGTGCTGGCGACGGACCTCGCCCTGGTCTGGGACCCGGAGTTCAAGGCCCAGACGGTC
ATGTACGCCGAGGACAACGAGCAGTTCCTGAAGGAGTTCGCGTCGGCCTGGACCGCCGTCATGATCGCCGACCGCTTCGACGGCCCCACCGGCAACGTCTGTCACGACGCCTCGGACAGC
GACGACAGCTCTGACGACAGCAGCAGCGACTCTGACAGCAGCGATAGCAGTGACAGCAGCGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCAGCAGCAGCAGCAGCAGCAGCGAC
AGCGACAGCGACGACCACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTCGCACGTGCAAACTCGGGGTCTTGGCCGCGCTCGCGTTGGCTGCAGTGCCCGCATCCGCCAGCTGCCCTTTCCTCGGTGGCCAGAAGGGCTCGCAACCCGACCTAGGCACCGGC
GTGGACCGTGCCCTGAGGTCCTACGATGACAGCTACTACTCCGGAAGCGGCGCGGACTTCTCGCGGGAGACCTACGAAGCACTCCAGGCCGACATCACGGCCGTGTTCACGGACTCGCAG
GACTTCTGGCCGGCGGACTTCGGCAACTACGCGCCGCTGATGATCCGCCTCGCGTGGCACTGCAACGGCAACTACCGCCAGTCGGACGGCCGCGGCGGGTGCGACGGCGGCCGGATCCGC
TTCAACCCGGAGCGCAGCTGGGCCGACAACACCAACCTCGACAAGGCGCTGACCCTGCTGCAGCCCATCAAGCTCAAGTACGGCGACGCCGTCTCGTGGGGGGACCTCATCACCCTCACG
GGTAACGAGGCGATCAGGTCGATGGGGGGCCCCGTGCTTGGGTTCTGCGCCGGGAGGCTGGACGACGCCTCCGGGTTCGACAGCCTCGAGCTCGGACCCTCACCCGAGCAGGAGGCCGTC
GCTCCCTGCGCCGTCAACGGGACGTGCGAGTTCCCCCTCGGCACCAGCACGGTGGGGTTGATCTACG
TGAACCCGGAGGGGCCCCTCGGTGTTCCCGACCCCGCCGGCAGCGCTGCCGAT
ATCCGTGACGTGTTTGGGCGCATGGGCATGAACGACAGCGAGACCGTGGCTCTTATCGGCGGAGGGCACGCGTTCG
GAAAATTCCACGGCGCGTGCGCCACCGGCCCCGGCCCCGACCCC
ACCGACGCCCCCGAAGCCCCCTGGCCGGGAACGTGCGGCGACCCCGACTCCCCGACCTTCGGCCGCGCGGAGAACACCTTCACGAGCGGGTTCGAGGGCCAGTGGACGGTGGAGCCCCTG
GTGTGGGACAACGCGTACTTCAAGGACCTCCTCGAGTACGACTGGGTGATGACGGAGAGTCCGGCGGACCAGGTCCAGTGGTTCCCGGTCCTGAAGGAGGGGGCCACGGAGACGGAGGAC
GAGATCCCCGACATCATCATGCTCACCAGCGACATCGCCTTGTTGTAT
GACGAGGAATACCTCGCCCTCGTGGAACTCTTCGCCAGCGACCTGTCCTACCTCGACACCGCCTTCGCCGCG
GCTTGGTACAAGCTCACCTCGCGGGACATGGGCCAGTTCCAGCGCTGCGTGGGCACCGACGTGGCGCCGCCCCAAGACTTCCAGCTGCCTCTCCCGGAGGCGCCGGCCGACCTCCCCGAC
ACCGACGGGGCCAAGTCGGCGATCATGAGCATCCTGTCCAGCGATCCGTCCTACCCCGCCCTGTTCGTCACGCTGGCTTGGCAGTGCGCGTCCACGTACCGCTCCACGGACTTCCTGGGC
GGCTGCAACGGGGCGAGGATCCGCTTCTCTCCCGAGAGGGACTGGGCCAGCAACCAGGGTCTCGACCAG
GTGCTGAGCCTGCTCGAGCCCGTGCAAGACGAGTACCCGGACGTGTCCTAC
GCCGACCTGATCGTGCTCGCGGGAAACCTCGCCCTCGACCTCGACGACCTCCCGTTCTGCGCCGGCCGCGTCGACGTCGCCGAGGGCGACGAGCTCATCTCGGTCCTCGAGCCCCGCGAG
TACGACGACGTCATCGTGGGCGTGCGCGACCGCATGAAGATCAGGGGCCTGTCGGTCGCGCAGATGGTGGCCCTCGCCGGCCGCCCCCGCAGCGCCTCGCACATGGTCACCCTCGGCTTC
AGCGGGTCCTACACGGACGAAGAGAACCCGCCCCTCTCGAACGCCTTCTACGTCACCCTCCTCACCGAGACCTGGGAAGAGGTGCCGGGATCGAACGGGCAGGAGTTCCAGGCCGTCGGC
AGGTCCGGCATTTACGTGCTGGCGACGGACCTCGCCCTGGTCTGGGACCCGGAGTTCAAGGCCCAGACGGTCATGTACGCCGAGGACAACGAGCAGTTCCTGAAGGAGTTCGCGTCGGCC
TGGACCGCCGTCATGATCGCCGACCGCTTCGACGGCCCCACCGGCAACGTCTGTCACGACGCCTCGGACAGCGACGACAGCTCTGACGACAGCAGCAGCGACTCTGACAGCAGCGATAGC
AGTGACAGCAGCGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCAGCAGCAGCAGCAGCAGCAGCGACAGCGACAGCGACGACCACTAA

Retrieve as FASTA