Entry information : SbRboh03 (Sobic.003G287400.1[2.1] / Sb03g033800[1.4])
Entry ID 839
Creation 2008-11-18 (Christophe Dunand)
Last sequence changes 2014-08-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-08-05 (Christophe Dunand)
Peroxidase information: SbRboh03 (Sobic.003G287400.1[2.1] / Sb03g033800[1.4])
Name (synonym) SbRboh03 (Sobic.003G287400.1[2.1] / Sb03g033800[1.4])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Seedlings
Inducers Dark growth
Phosphate starvation
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value SbRboh03
start..stop
S start..stop
ZmRboh05 1848 0 1..944 1..942
OsRboh02 1712 0 1..944 1..943
OsRboh05 1670 0 7..944 15..951
SbRboh09 1660 0 11..944 18..957
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62061719..62062367 649 N° 2 62062457..62062616 160 N° 3 62062725..62062773 49 N° 4 62063597..62063710 114
N° 5 62065262..62065684 423 N° 6 62066369..62066752 384 N° 7 62066832..62066927 96 N° 8 62067008..62067123 116
N° 9 62067260..62067427 168 N° 10 62067518..62067677 160 N° 11 62067826..62068023 198 N° 12 62068133..62068261 129
N° 13 62068429..62068507 79 N° 14 62068920..62069029 110  
join(62061719..62062367,62062457..62062616,62062725..62062773,62063597..62063710 ,62065262..62065684,62066369..62066752,62066832..62066927,62067008..62067123,620 67260..62067427,62067518..62067677,62067826..62068023,62068133..62068261,6206842 9..62068507,62068920..62069029)


exon

Literature and cross-references SbRboh03 (Sobic.003G287400.1[2.1] / Sb03g033800[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_3 (62061719..62068993)
Protein sequence: SbRboh03 (Sobic.003G287400.1[2.1] / Sb03g033800[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   944
PWM (Da):   %s   106500.84 Transmb domain:   %s   o383-402i521-543o563-585i742-759o
PI (pH):   %s   9.59
Sequence 986
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGGAAPGHQRWSGSAGTTPRSLSTGSSPRGSERSSDDGEELVEVTLDLQEDDTIILRSVEPAAAGAANGLPLGARGDHAGGASSSSRSRSPSIRRTSSHRLLQFSQELKAEAMSIARQFSQDLTKRFGRTQSRAEGQGQQQQQPSSGIESALAARAARRQRAQLDRTRSGAHKALRGLRFISSNKANNAWMEVQANFDRLACDGFLSRSDFAECIGMTESKEFALELFDTLSRRRQMQVDKINKEELREIWQQITDNSFDSRLQIFFDMVDKNADGRIGEEEVKEIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYMNYSQALSYTSQALSQNLAGLRKKSPIRKISTTLSYYLEDNWKRLWVLALWIGIMAGLFTWKFMQYRNRYVFNVMGYCVTTAKGAAETLKLNMAIILLPVCRNTITWLRNTRAARALPFDDNINFHKTIAAAIVVGIILHAGNHLVCDFPRLINSSNEKYAPLGQYFGETKPTYFRLVKGVEGITGVIMVICMIIAFTLATRWFRRSLVKLPKPFDKLTGFNAFWYSHHLFIIVYLALVVHGQFLYLIHDWYRKTTWMYLAVPVCLYAGERVLRFFRSGSYSVRLLKVAIYPGNVLTLQMSKPPAFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSIHVRQLGDWTRELKRVFAAACEPPVGGKSGLLRADETTKKALPKLLIDGPYGSPAQDYSKYDVLLLVGLGIGATPFISILKDLLNNIIRMEEEEDASTDLYPPVGPNKPHIDLSTLMTVTSRPKRVLRTTNAYFYWVTREQGSFDWFKGVMNEIAELDQRNIIEMHNYLTSVYEEGDARSALITMLQALNHAKNGVDIVSGTKVRTHFARPNWKKVLSKIASKHPHAKIGVFYCGAPVLAQELNKLCHEFNGKSTTKFEFHKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 13 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGGGGCGGCGCCGCCCCGGGCCACCAGCGATGGAGCGGCTCGGCGGGGACAACGCCGCGGTCGCTCAGCACGGGCTCCTCGCCGCGGGGCTCCGAGCGCAGCTCCGACGACGGGGAGG
AGCTGGTCGAGGTTACGCTCGACCTGCAGGAGGACGACACCATCATTCTGCGGAGCGTCGAGCCGGCCGCGGCGGGGGCCGCCAACGGGCTGCCGCTGGGCGCGCGCGGGGACCATGCGG
GCGGCGCGTCGTCGTCGTCGCGGTCACGGTCGCCGTCGATCAGGCGGACCTCGTCGCACCGGCTGCTGCAGTTCTCGCAGGAGCTCAAGGCGGAGGCCATGTCCATCGCGCGCCAGTTCT
CGCAGGACCTCACCAAGCGCTTCGGCCGCACCCAGAGCCGCGCGGAAGGGCAGGGGCAGCAGCAGCAGCAGCCGTCGTCAGGCATCGAGTCGGCCCTCGCTGCCCGCGCCGCGCGGCGGC
AGCGCGCGCAGCTCGACCGCACGCGCTCCGGCGCGCACAAGGCGCTCCGCGGTCTCCGCTTCATCAGCAGCAACAAGGCCAACAACGCCTGGATGGAGGTGCAGGCCAACTTCGACCGCC
TCGCCTGCGACGGCTTCCTCTCCCGCTCCGACTTCGCGGAATGCATTG
GTACCACCACCCCGCGCTGCCTCCCCTCGACTTTCTCCCCCCATTTCGCTTCGTCGTTGAAACATTGGGAGC
TGCACGTGCACGTGCAGGGATGACGGAATCGAAAGAGTTCGCGCTCGAGCTGTTTGACACATTGAGCCGCCGCCGTCAGATGCAGGTCGACAAAATCAACAAGGAGGAGCTGCGCGAGAT
CTGGCAGCAGATCACGGACAACAGCTTCGATTCTCGCCTCCAGATCTTCTTCGACAT
GTAGACCACCCCGCCACCATGCTCACCATTACGCCACTCTTAGCTAGCTACTATGAGACTCGT
CTATTGTTTTCAATAACCGTATTGATTTTGTCATTTTTTAATTAGGGTGGATAAGAACGCGGACGGCCGGATTGGGGAGGAGGAGGTGAAAGAGGTAAGCAACAAACACCCATGCCCATG
GCTGTGCTTGGAGTTGGTGGTGCTGCACTACAAGCAGTTTCTTTCCCTTTTCTTTCGTCCTTTCTTTTTCTGATTTGCTATTTGGGGATATCAAAATCGGATCGTTTAGCTGTCCTTTGA
CGGCAAGAGTTTTATATTGTCCATTGAGCTGTCTAATTTCTCGGCACTGCCACAGCAATATCTGTTTTTGTTCTGCGAATAGGTAGCGCATCCATATCGCAGACCTTGCGGATTACTATT
GTTTCTTAATTATTTTTGAGTGGTCAGTGGTGGAGAAATCTTAGTTAACCTGTGATAATCCGACAAGAGGAGGGTCTTGGAGGAAATCCTCGCAGGGTGTACGCGAAAAGTATTTGCGTC
TAATCGTAGTCGGTGAGCGAAACCGGCGTGGAAAGCATCACGCCGTTACCCACTCCCTACCTGCTTGTTTTAGGACACTCGTTTTTTCTCTCTTAGCCTTCAGGAGAGGGGCACCCTTCT
TTCTAGAACGTGTGAGGGCATTCCAGTAAATTTTCAGTGGACGGCAGTCTGCAGTCTAGCGGCAGTAGGTAAGGGGCATTTCCGACAGGCCAGCTAATCTTTTTTTTTTCCTTGCATCCA
ATGCGTTGAAAGGTGACTTGGTGAGCGTTAAGTAGCTTTTGAAAGGCATGTGGGTGCCTTTCGACGATGTTACTGTTAGGAACTGAATCAGCCATATGCTGTTATGGGTTACTTTCTAGT
GGTTTGGTAAAATATGAAATCACGCTGAGTTTGCGCTCCAACACTGTACTAACTCGTTTATCTTTGTACTGTTCCAGATTATCATGTTAAGTGCATCTGCCAACAAGCTGTCCAGGCTTA
AGGAGCAAGCTGAAGAGTATGCCGCCCTGATCATGGAGGAGCTTGATCCTGAAGGACTTGGCTACATTGAG
GTAAGCTAACATTGTTAGCAATCAATCACACAGTTATGCAGTGAAACAG
TTTGGCTCCCGACCACTTGTTTATTGCCAGCAACAGTGGTGACAATAGTATAATTAGGTGAAAGAAGTGTCAGTATTTGGTTAGCCTCATATAGAATTTTGGCAGCTAGTTCACATACAT
GTTGATCAGTGCACACTGAGAAGTAGTTGACTGCGGCTTTGTCTCTTATGACATGATAGTGGATTAGTACCAAACATTATAAGACTTGTCTTTGATTATCTAAACTTCATTTTCTATCGC
ATTACTTGGCGCTACCGCGCTATAACCAGCCAAAGAGGCTGCCCATTCTGTGGTAGAAATAAAATTTTGCCTCTGGAAATGTTTTTTTAAAAGGACGGCAAAAGCTTTACCATAATTTTT
ATTATAAGAACAAAAAAAAAAGATGATGGCCCAGTTTTTTTAGTGGGAATTGGGCGCAAAAACCACCGCCCCTGGAAATGTTAGTCTGAGTACATGCAGTTAATTTACTGTTCGATACAA
AAAAAATGGGAATGGTACCCAATAAAATCCTTTTTCCCATCATCATTTATGTCGAAGTTGGTGAGCAGCTATGGATCAGCTTGTATGCATTTCTTATGTTTCATTCATTTGCCGTGTTCA
GTGTCATCCTTGCTGCTCACAGTTCACAGCTTGTTGCCCCCACCACGTTCTCATGGCCATTGACCTCCTTTTCTTTTAAAGAGTGCTGTAATCTGTCTGTACTTCCTCAGTCCCCAAAAG
ACTTCAACTCTTTTGGGGAGAAACAATTTTAATTAACATTTAAGCTACCAAAAAGTATCATTATATTAATTATATAATATATTTTCATAGAAAACCTATTTAGAGGCATAAATGTTGATA
CTATTTTCCATGCGTTATACTTTAGTACATCTCACTTTATGGTATGCCTTTTATAAATCCTAGTGGTGTGTGTTGGTGTGCCTTTGTATGGGATCTTTTCCCATTTTTTCTCTTAATATA
GTGATACCAGTTCTCCTGTTTGAGGAAAAAAAATTCTTTTGTAAATGCCATTTTTTTTTATTGACGTGATATGCTAAAATATTCATACAGTACAGTAAGGCCACTTCAATTTTTGGTGTC
TTTCAAGGGAAAAATCCCTCAATAACTTGTCTAGATGTCTTTTCTTACATAATTGTGTGTTTACTTCCTTTTGAAGAATTATTTTAATTCTATGTGCACATAATCTTTTGGGGCGCATTA
TGGATTTGCTTTTATGCATATAAATCTTGTTTCTCTAGAGCATGAGTTGTTCAGCTGATGAGGGTATTTTTCTGTTTTAGAGTTAGAACACTGTATTTAACTTGTACTCTTGTAGTAGTT
ACATCAGCCTTAGTTGTCTCCGGATGTGCGCTTATCAGCATTTTATTACAAATGCAACAATGCCTATTATTTGTTAATAGAGTATTATTTTTATTAATTTTTTTATTAATCAAACCCGTT
ACTATTGAAGTAGCCTTTGTTCTTTTCCCCTAAAGAATGCGTGGGTTTTATTGGTATTGCAGTTGTGGCAGTTGGAGACCCTTCTGTTGCAGAAGGATACCTACATGAACTACAGTCAGG
CGCTAAGTTATACAAGCCAAGCACTAAGTCAGAACCTAGCAGGCTTAAGGAAAAAGAGTCCAATTCGCAAGATAAGTACCACATTGAGTTACTACTTGGAGGATAATTGGAAACGCCTAT
GGGTGCTTGCATTATGGATTGGAATAATGGCTGGACTGTTCACTTGGAAGTTCATGCAGTATCGCAACAGGTATGTCTTTAATGTGATGGGCTACTGCGTGACCACTGCAAAAGGCGCTG
CTGAAACCCTGAAGCTGAACATGGCAATTATCCTCCTCCCAGTATGCCGTAACACCATTACTTGGTTGAGAAATACAAGGGCTGCACGGGCATTACCATTTGATGATAATATAAACTTCC
ACAAG
GTTAGTCATTAGTTTGTCAGTGCCTCTTTTTATTCTGCCAATATAGTTTCAGAGTTTCATGTTAATGAGTTAATTTTTACTTAAATCAGTTAATTTAGGACTGAAAGGATGTAAA
TGGGCATTTGCATCATCTGTTCATGTTGATGCAGGATATTCTGCTTTATTTTCACGTGCTTAACCTTATTTTTCTAAAAAAAGATCATGTACTTAGTGAGTCTGAATATAGGTGTTTGCC
CTTCTTCTACCTTTTTATTCTATGTTTGTACTTATTGTACCAATTCATTGTGAGCCAAATAAATTCATTCAGTTTATCTAAAAAAAAGTATGTTCAGTTACTCATGTCCAGTGGGATGCT
TAATTCTGTGACAGTTTATATATGAATTATATGCAGAGCATAACAACTACGCAAAATACAAAATGTATTCTCCACCTAAGTCGGCAATCTGTGGGTTGATGAAGTGATCCATCCTCTCTG
TACAGAAACACATCTAGTATTTCCTTTTTTTTAACCTTCAATGATAAAATATGCTTGCTCATCTCCAACTAGAAAGAATAGCTTTATCATATGGCTATACAGGGATTTGAGTTACATGGA
AAGCTACTCCCTAGATACAACATATGAAATATGAGACTTTGACTACGAAAACTAATAAAAAGAACTTATTTTGTTGTTTTAATGGGCAGACTATTGCAGCAGCAATCGTTGTTGGTATAA
TCCTCCATGCAGGGAATCACCTTGTGTGTGATTTTCCACGACTTATAAATTCATCAAATGAGAAGTATGCTCCTCTGGGCCAGTACTTCGGTGAAACAAAGCCAACATACTTTAGATTGG
TCAAAGGAGTGGAAGGCATCACTGGTGTAATTATGGTTATATGTATGATTATTGCTTTCACTTTAGCAACACGGTGGTTCCGCCGTAGCCTGGTGAAGCTTCCAAAACCATTTGACAAAC
TGACTGGCTTCAATGCCTTCTGGTACTCTCATCACTTATTCATAATTGTGTATTTGGCTCTCGTTGTTCATGGCCAGTTCCTGTACCTCATTCATGACTGGTACCGAAAAACG
GTGAGTT
TTTTTATTTGTTTTCATTCTTTGCACATGAAATAATCAAAGTTTGAGTCCTAAGGTTCTTGTATTTTTGCAGACATGGATGTATCTGGCAGTGCCTGTTTGCTTGTATGCAGGGGAGAGG
GTGCTGAGGTTCTTCAGGTCTGGCAGTTATTCTGTCAGGCTATTGAAG
GTCAATCAAAAAGACATGAGAAACTTGAGCATTCATTTTCTGTGGACCTACTAATCTAGTTATTGTTATTTT
CCTTTCAGGTGGCCATATATCCTGGTAATGTGTTGACACTGCAAATGTCCAAGCCTCCTGCTTTCCGATACAAGAGTGGGCAATATATGTTTGTTCAATGTCCAGCAGTGTCACCCTTTG
AATG
GTAATTTGTACTTGTAGCAATAAATTTTGATTGAATTATGCCATTGCTTGGATAGAAATTACCAACTTTCATGAATGCTTCATAATTAGTCTCGATGAAACCCATTGAGCACTGAG
CATTTCCATTCTCTTCATAGGCATCCGTTCTCAATTACTTCAGCGCCTGGGGATGATTATCTCAGCATTCATGTTCGACAACTTGGTGACTGGACACGAGAGCTGAAGAGGGTTTTTGCA
GCAGCTTGTGAACCCCCAGTGGGTGGTAAAAGTGGCCTTCTTAGAGCAGATGAGACAACCAAGAAAGC
GTATGAGCCCTCAATCATAGAGGCTTGATTTTGTGTGTAATAGGTCTTTAAC
GAATTACATGTTATAATATTTGTCTTTGGATAATGCAGCTTACCAAAACTTCTGATTGATGGACCTTATGGTTCTCCTGCTCAGGATTACAGCAAGTATGATGTTCTTCTACTTGTTGGA
TTAGGAATTGGTGCAACTCCTTTTATCAGCATACTGAAAGATCTTCTTAATAATATCATAAGGATGGAGGAAGAGGAG
GTAATTTACTATCTATCTTCACTTGTCACCATCAGACCTTCC
TAATCCCATCAGTGAAATAACAGATCACATATGAAAAATATTCTTTCTGTAGGGTTTTGGTATTTTGCTAACAACAATTCTGTTTTATGTGTGCCTGTGTTAGCAGGATGCTTCCACTGA
TCTTTATCCTCCAGTTGGTCCGAATAAGCCGCACATTGATCTGAGCACACTTATGACGGTAACATCAAGACCAAAGAGGGTTCTAAGGACCACAAACGCTTACTTTTATTGGGTTACACG
TGAGCAAGGTTCTTTTGATTGGTTCAAGGGAGTCATGAATGAGATTGCTGAACTGGACCAAAGG
GTACATAGTACCAATTGACCACTTGTTTTGTTCAAGTTACATTTTTAATTGTCAGA
ATTAATATGTTTCCTTAAGTGGGTTTTACTTACAGTTTGCCTTTGCATTCTAGAATATCATTGAGATGCATAACTACCTCACGAGTGTTTATGAGGAAGGGGATGCTCGGTCAGCGCTCA
TCACCATGCTTCAAGCTTTGAACCATGCAAAGAATGGTGTTGACATTGTCTCTGGAACTAAA
GTAAGTGCTGATAGAGCAATTAACAGCTCCACTCTCCGTTAAGTCAGTAATGTTGGAA
TGCTGAGTTTTGTACATGTCATCTATTAGCATAAATGATTAAGACTGTACAATCACTTTTTAAGGCATAAGGTAATACTCCCATCAAAATATGTATGCTGATTATGCAGGTCCGGACACA
CTTTGCAAGACCAAATTGGAAAAAAGTCCTATCTAAAATTGCCTCCAAGCATCCACATGCCAAGATAG
GTTAGTCTACATACTACATTGCCAGATATTCTGGTTAAACTTCTCAGTATTT
TTTATAGAGTCATGCACATATTTGTGAATGACTTGTGTGTCCTTTATCAAAACTTCATCTGTGTTAAACACACCGCTGCATAAAGATGCAGATGCATTAACAATTTATAGCAATTAAGCT
TTGGCCTGCATGATTGAGCGAAACAGTGAGAATAACCAGCCCAGTTTTATTTAGAATTCCATTTCCATGAACAAAGTTTACTATGGTGTGTGGGGTGCATTGTAATCAAGCTATTTCTAT
ATTAATTAATGGCAATATTAGTATAATGGCACAGTTATCCTGTGTGTTCCAGAAAAAGAAAATAAATTATGTACCGCCTATACATTTTTTATTTTTTAAAAATGATTTGGTTGCACGCAG

GTGTATTCTACTGTGGAGCTCCAGTTCTTGCACAAGAACTAAACAAACTGTGCCACGAATTCAATGGGAAAAGCACAACGAAATTTGAGTTCCACAAGGAGCATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGGGGCGGCGCCGCCCCGGGCCACCAGCGATGGAGCGGCTCGGCGGGGACAACGCCGCGGTCGCTCAGCACGGGCTCCTCGCCGCGGGGCTCCGAGCGCAGCTCCGACGACGGGGAGG
AGCTGGTCGAGGTTACGCTCGACCTGCAGGAGGACGACACCATCATTCTGCGGAGCGTCGAGCCGGCCGCGGCGGGGGCCGCCAACGGGCTGCCGCTGGGCGCGCGCGGGGACCATGCGG
GCGGCGCGTCGTCGTCGTCGCGGTCACGGTCGCCGTCGATCAGGCGGACCTCGTCGCACCGGCTGCTGCAGTTCTCGCAGGAGCTCAAGGCGGAGGCCATGTCCATCGCGCGCCAGTTCT
CGCAGGACCTCACCAAGCGCTTCGGCCGCACCCAGAGCCGCGCGGAAGGGCAGGGGCAGCAGCAGCAGCAGCCGTCGTCAGGCATCGAGTCGGCCCTCGCTGCCCGCGCCGCGCGGCGGC
AGCGCGCGCAGCTCGACCGCACGCGCTCCGGCGCGCACAAGGCGCTCCGCGGTCTCCGCTTCATCAGCAGCAACAAGGCCAACAACGCCTGGATGGAGGTGCAGGCCAACTTCGACCGCC
TCGCCTGCGACGGCTTCCTCTCCCGCTCCGACTTCGCGGAATGCATTG
GGATGACGGAATCGAAAGAGTTCGCGCTCGAGCTGTTTGACACATTGAGCCGCCGCCGTCAGATGCAGGTCG
ACAAAATCAACAAGGAGGAGCTGCGCGAGATCTGGCAGCAGATCACGGACAACAGCTTCGATTCTCGCCTCCAGATCTTCTTCGACAT
GGTGGATAAGAACGCGGACGGCCGGATTGGGG
AGGAGGAGGTGAAAGAG
ATTATCATGTTAAGTGCATCTGCCAACAAGCTGTCCAGGCTTAAGGAGCAAGCTGAAGAGTATGCCGCCCTGATCATGGAGGAGCTTGATCCTGAAGGACTTG
GCTACATTGAG
TTGTGGCAGTTGGAGACCCTTCTGTTGCAGAAGGATACCTACATGAACTACAGTCAGGCGCTAAGTTATACAAGCCAAGCACTAAGTCAGAACCTAGCAGGCTTAAGGA
AAAAGAGTCCAATTCGCAAGATAAGTACCACATTGAGTTACTACTTGGAGGATAATTGGAAACGCCTATGGGTGCTTGCATTATGGATTGGAATAATGGCTGGACTGTTCACTTGGAAGT
TCATGCAGTATCGCAACAGGTATGTCTTTAATGTGATGGGCTACTGCGTGACCACTGCAAAAGGCGCTGCTGAAACCCTGAAGCTGAACATGGCAATTATCCTCCTCCCAGTATGCCGTA
ACACCATTACTTGGTTGAGAAATACAAGGGCTGCACGGGCATTACCATTTGATGATAATATAAACTTCCACAAG
ACTATTGCAGCAGCAATCGTTGTTGGTATAATCCTCCATGCAGGGA
ATCACCTTGTGTGTGATTTTCCACGACTTATAAATTCATCAAATGAGAAGTATGCTCCTCTGGGCCAGTACTTCGGTGAAACAAAGCCAACATACTTTAGATTGGTCAAAGGAGTGGAAG
GCATCACTGGTGTAATTATGGTTATATGTATGATTATTGCTTTCACTTTAGCAACACGGTGGTTCCGCCGTAGCCTGGTGAAGCTTCCAAAACCATTTGACAAACTGACTGGCTTCAATG
CCTTCTGGTACTCTCATCACTTATTCATAATTGTGTATTTGGCTCTCGTTGTTCATGGCCAGTTCCTGTACCTCATTCATGACTGGTACCGAAAAACG
ACATGGATGTATCTGGCAGTGC
CTGTTTGCTTGTATGCAGGGGAGAGGGTGCTGAGGTTCTTCAGGTCTGGCAGTTATTCTGTCAGGCTATTGAAG
GTGGCCATATATCCTGGTAATGTGTTGACACTGCAAATGTCCAAGC
CTCCTGCTTTCCGATACAAGAGTGGGCAATATATGTTTGTTCAATGTCCAGCAGTGTCACCCTTTGAATG
GCATCCGTTCTCAATTACTTCAGCGCCTGGGGATGATTATCTCAGCATTC
ATGTTCGACAACTTGGTGACTGGACACGAGAGCTGAAGAGGGTTTTTGCAGCAGCTTGTGAACCCCCAGTGGGTGGTAAAAGTGGCCTTCTTAGAGCAGATGAGACAACCAAGAAAGC
CT
TACCAAAACTTCTGATTGATGGACCTTATGGTTCTCCTGCTCAGGATTACAGCAAGTATGATGTTCTTCTACTTGTTGGATTAGGAATTGGTGCAACTCCTTTTATCAGCATACTGAAAG
ATCTTCTTAATAATATCATAAGGATGGAGGAAGAGGAG
GATGCTTCCACTGATCTTTATCCTCCAGTTGGTCCGAATAAGCCGCACATTGATCTGAGCACACTTATGACGGTAACATCAA
GACCAAAGAGGGTTCTAAGGACCACAAACGCTTACTTTTATTGGGTTACACGTGAGCAAGGTTCTTTTGATTGGTTCAAGGGAGTCATGAATGAGATTGCTGAACTGGACCAAAGG
AATA
TCATTGAGATGCATAACTACCTCACGAGTGTTTATGAGGAAGGGGATGCTCGGTCAGCGCTCATCACCATGCTTCAAGCTTTGAACCATGCAAAGAATGGTGTTGACATTGTCTCTGGAA
CTAAA
GTCCGGACACACTTTGCAAGACCAAATTGGAAAAAAGTCCTATCTAAAATTGCCTCCAAGCATCCACATGCCAAGATAGGTGTATTCTACTGTGGAGCTCCAGTTCTTGCACAAG
AACTAAACAAACTGTGCCACGAATTCAATGGGAAAAGCACAACGAAATTTGAGTTCCACAAGGAGCATTTCTGA

Retrieve as FASTA