Entry information : DpuKat01
Entry ID 8407
Creation 2011-05-29 (Marcel Zamocky)
Last sequence changes 2011-05-29 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-05-30 (Christophe Dunand)
Peroxidase information: DpuKat01
Name DpuKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Dictyostelium
Organism Dictyostelium purpureum    [TaxId: 5786 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value DpuKat01
start..stop
S start..stop
DdKat01 912 0 1..496 1..496
PpalKat01 889 0 1..496 1..496
CowKat01 674 0 6..480 4..476
NgrKat01 659 0 3..482 10..486
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4626..5068 443 N° 2 5186..6233 1048  
join(4626..5068,5186..6233)


exon

Literature and cross-references DpuKat01
Literature Sucgang R., Kuo A., Tian X., Salerno W., Parikh A., Feasley C.L., Dalin E., Tu H., Huang E., Barry K., Lindquist E., Shapiro H., Bruce D., Schmutz J., Salamov A., Fey P., Gaudet P., Anjard C. , Mohan M.B., Basu S., Bushmanova Y., van der Wel H., Katoh-Kurasawa M., Coutinho P.M., Saito T., Elias M., Schaap P., Kay R.R., Henrissat B., Eichinger L., Rivero F., Putnam N.H., West C.M., Loomis W.F., Chisholm R.L., Shaulsky G., Strassmann J.E., Queller D.C., Kuspa A., Grigoriev I.V. (unpublished since 2010)
Protein ref. GenBank:   EGC30630.1 UniProtKB:   F0ZZJ3
DNA ref. GenBank:   GL871313.1 (4626..6233)
EST ref. GenBank:   GR584599.1 [3' end]   GR584598.1 [Fragment]
Protein sequence: DpuKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   496
PWM (Da):   %s   55848.68  
PI (pH):   %s   8.77
Sequence 537
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTPVLTTSNGAPVDNNLNSMSVGNPGPLLLQDFHLIDKLSHFDRERIPERVVHAKGAGAHGYFEVTNPDIPKWCRAKFLNKVGKRTPIFTRFSTVGGEKGSSDSERDPRGFAVKFYTEEGNWDMVGNNTPVFFIRDPSKFPDFIHTQKRNPQTNCKDPNMFWDFLGLTPESTHQVMILFSDRGTPKSYRHMHGFSSHTLKMVNQQNKASWVKFHFISETGIQNFTAEEAGKLSSTDPDSATRDLFESISKGVEPAWKVSIQVMEHDDAFKYRFDPFDVTKVWPHKDYPLIPIGRMVLNRNPENYFAEVEQAAFSPSHMVPGIEPSFDKMLQGRLFSYPDTHRHRLGVNYQQIPINCPYAARGGVKNYQRDGFMAVNGNGGKGPNYQPNSFNGPEPNPEFTQHKFEISGVGARQPYTHPNDDFIQPGNLYRLMDEGAKSRLASNLVGHMQGVTVREILLRAVSNFYKADKDLGARLCKGLGIDVNDVVKFTTRSNL

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo unknown, 1 intron) and 5 ESTs (GR584624.1, GR586565.1,GR584625.1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACAACACCAGTTTTAACTACATCAAATGGTGCTCCAGTAGACAATAATTTAAATTCAATGTCTGTTGGTAATCCAGGTCCACTCTTATTACAAGACTTTCATTTAATCGACAAACTTT
CACACTTTGATCGTGAACGTATCCCAGAACGTGTTGTTCATGCTAAAGGTGCTGGTGCCCATGGTTATTTCGAAGTTACCAATCCAGATATTCCAAAATGGTGTAGAGCTAAATTTTTAA
ACAAAGTTGGTAAAAGAACTCCAATCTTTACCCGTTTCTCAACTGTTGGTGGTGAAAAGGGTTCATCTGACTCTGAAAGAGATCCAAGAGGTTTTGCTGTTAAATTCTACACTGAAGAAG
GTAATTGGGATATGGTTGGTAATAACACTCCAGTTTTCTTTATTCGTGACCCAAGCAAATTCCCAGATTTCATTCACACACA
GTAAGTATTTATTAATATTATATGTATATATTTTAATG
TTTTAAAAAAATATTATTTTTCTTTTATTATTATTTTAAAATTCATAAAATTAATTTAATTTTTTTTTCACTCAAATAGAAAACGTAATCCACAAACCAATTGCAAAGATCCAAATATGT
TCTGGGATTTCTTAGGTCTTACCCCAGAATCAACTCATCAAGTTATGATTTTATTCTCAGATAGAGGTACACCAAAATCATACCGTCACATGCATGGTTTCTCATCACATACATTAAAGA
TGGTCAATCAACAAAACAAAGCATCATGGGTTAAATTCCACTTTATCTCAGAAACCGGTATTCAAAACTTTACCGCTGAAGAAGCTGGCAAACTTTCATCAACTGACCCAGATTCAGCCA
CCAGAGATCTCTTTGAATCTATTTCAAAAGGTGTTGAACCAGCTTGGAAAGTTTCAATTCAAGTTATGGAACATGATGATGCCTTCAAATACCGTTTCGATCCATTCGATGTCACCAAGG
TTTGGCCACACAAAGATTATCCATTAATCCCAATTGGTCGTATGGTATTAAACCGTAACCCAGAAAACTACTTTGCTGAAGTCGAACAAGCTGCATTCTCACCATCACACATGGTCCCAG
GTATTGAACCATCATTCGATAAAATGCTCCAAGGTCGTCTCTTCTCATACCCAGATACCCATCGTCATCGTCTCGGTGTTAACTATCAACAAATCCCAATCAATTGCCCATACGCCGCCA
GAGGTGGTGTTAAAAACTACCAACGTGATGGTTTCATGGCTGTTAATGGTAACGGTGGTAAAGGTCCAAACTACCAACCAAACTCATTCAATGGTCCAGAACCAAACCCAGAATTTACTC
AACACAAATTCGAAATCAGCGGTGTTGGTGCTCGTCAACCATACACTCATCCAAATGATGATTTCATTCAACCAGGTAACTTATACAGACTCATGGATGAAGGTGCTAAATCACGTCTCG
CTAGTAATTTAGTTGGTCACATGCAAGGTGTCACTGTTCGTGAAATCCTTCTTCGTGCCGTATCAAACTTCTATAAAGCCGATAAAGATTTAGGTGCCCGTCTCTGTAAAGGTCTTGGTA
TTGATGTCAACGATGTCGTTAAATTCACCACTAGATCAAACTTGTAA

Retrieve as FASTA