Entry information : PEchKat03
Entry ID 8417
Creation 2011-06-01 (Marcel Zamocky)
Last sequence changes 2012-04-26 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: PEchKat03
Name PEchKat03
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Penicillium
Organism Penicillium chrysogenum    [TaxId: 5076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PEchKat03
start..stop
S start..stop
AnKat02 1150 0 1..730 1..726
CheKat03_C5 975 0 2..729 5..729
CheKat03_C4 975 0 2..729 5..729
CgKat02 965 0 10..729 14..704
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1779725..1780018 294 N° 2 1780073..1780298 226 N° 3 1780351..1780766 416 N° 4 1780818..1780982 165
N° 5 1781030..1781204 175 N° 6 1781267..1782183 917  
join(1779725..1780018,1780073..1780298,1780351..1780766,1780818..1780982,1781030 ..1781204,1781267..1782183)


exon

Literature and cross-references PEchKat03
Literature van den Berg M.A., Albang R., Albermann K. et al. (2008) Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 26:1161-1168
Protein ref. UniProtKB:   B6H9T9
DNA ref. JGI genome:   scaffold_4 (1779725..1782183)
Protein sequence: PEchKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   730 (714)
PWM (Da):   %s   79712.91 (78167.0)  
PI (pH):   %s   5.32 (5.24) Peptide Signal:   %s   cut: 17 range:17-730
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHVLALVTGLVGVANAACPYMTGEAANPHIERRADGDAAANTEEFLSQFYLNDQDVYLTSDVGGPIEDQNSLSAGERGATLLEDFIFRQKIQRFDHERVPERAVHARGAGAHGTFTSYGDWSNLTAASFLSAEGKQTPMFTRFSTVAGSRGSADTARDVHGFATRFYTDEGNFDIVGNNVPVFFIQDAILFPDLIHAVKPRGDNEIPQAATAHDSAWDFFSQQPSTLHTLLWAMAGHGIPRSFRHVDGFGVHTFRLVTDDGKTKLVKFHWKGLQGKASFVWEEAQQTAGKNADFMRQDLFESIEAGRFPEWLGVQIMEEEDQLRFGFDLLDPTKIVPEELVPVTILGKMQLNRNPMNYFAETEQVMFQPGHIVRGVDFTEDPLLQGRLFSYLDTQLNRHGGPNFEQLPINRPRAPIHNNNRDGAGQMFIPLNPNAYSPNTENKGSPKQANQTVGKGFFTAPERTASGKLQRTLSTTFEDNWSQPRLFWNSLVDAEKQFIVDAMRFETSNVKSSVVRNNVIIQLNRISNDLATRVAKAIGVEAPKPDDSFYHDNTTAHIGAFGQKLAKLDGLKVGLLASVDKPASIAQGAKLQSALSSAGVDVVVVAERMADDVDQTYSASDAVQFDAVVVADGAEGLFGAKSFTTQPTKGSGASTLYPAGRPLDILLDAFRFGKTVGALGKGSDALQSGQISSEREGVYTGKDAGDAFAKDIKEGLSTFKFLDRFAVDQ

Retrieve as FASTA  
Remarks complete sequence from genomic (5 introns). Strain="Wisconsin 54-1255". No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGTCCTTGCCCTCGTCACGGGCCTTGTTGGCGTTGCCAATGCTGCCTGTCCTTATATGACTGGCGAGGCCGCCAATCCTCACATCGAGCGTCGCGCAGACGGAGATGCTGCTGCC
AACACCGAAGAATTCCTCTCCCAATTCTACCTCAACGACCAAGACGTCTATCTGACCTCCGACGTTGGTGGCCCGATCGAGGACCAAAACAGTCTCAGCGCAGGAGAGCGTGGAGCGACC
CTGCTCGAGGATTTCATTTTCCGCCAGAAGATCCAGCGCTTCGATCATGAACGA
GTACGTTTTCTGCATTTTCAATTCAAGTTCTAAAGCTCATGTCCATTTTCCAAGGTACCGGAACGC
GCCGTTCACGCTCGAGGCGCCGGCGCCCACGGAACATTCACCTCCTACGGTGACTGGTCCAACCTGACTGCCGCTTCTTTCCTTTCCGCCGAGGGCAAACAAACCCCAATGTTCACGCGC
TTCTCCACCGTCGCTGGTAGCCGCGGAAGCGCTGACACCGCGCGAGACGTCCACGGCTTCGCGACTCGCTTCTATACCGATGAAGGAAACTTTG
GTATGGCAGACTCCCTTCTGAAAAGC
AAAGGACACAGCTGATTTGGAGATAGATATTGTTGGAAACAACGTTCCCGTTTTCTTCATCCAGGATGCCATCCTGTTCCCGGATCTCATTCACGCCGTCAAGCCCCGTGGCGACAACGA
GATCCCCCAGGCTGCTACCGCGCACGACTCCGCTTGGGATTTCTTCAGCCAGCAACCTAGCACACTTCACACCCTTCTGTGGGCAATGGCTGGCCACGGTATTCCCCGTTCGTTCCGTCA
CGTTGATGGATTCGGTGTGCACACCTTCCGTTTGGTTACTGACGACGGAAAGACCAAGCTTGTCAAGTTCCACTGGAAGGGACTGCAGGGCAAGGCCAGCTTTGTCTGGGAGGAGGCCCA
GCAAACCGCTGGTAAGAATGCGGACTTTATGCGCCAGGACCTTTTCGAATCCATTGAGGCTGGACGTTTCCCCGAGTGGGAG
GTAAGTGACACTCCAAATAACCATTCGCAACTCTCGCT
AATTATTCGCTAGCTTGGTGTCCAAATCATGGAGGAAGAGGACCAGCTTCGATTTGGATTTGATCTCTTGGACCCTACCAAGATCGTCCCTGAGGAACTCGTTCCTGTCACCATCCTGGG
CAAGATGCAACTGAACCGCAACCCTATGAACTACTTCGCCGAGACCGAGCAAGTCATG
GTATGTCTCGTCCCATTATCACCAGCGAGTAATACTAATTTCCTCAGTTCCAACCGGGCCAC
ATCGTCCGCGGCGTCGACTTCACCGAGGACCCCCTCCTCCAGGGCCGTCTCTTCTCCTACCTCGACACTCAGCTCAACCGCCACGGTGGTCCCAACTTCGAGCAGCTCCCCATCAACCGT
CCCCGCGCACCAATCCACAACAACAACCGTGACGGCGCAG
GTACGTACCTACTACAAGCCCAATCTCACTCCCAAAAACCCCCCTTCCTAACAAAAATCTAGGCCAAATGTTCATCCCGC
TGAACCCCAACGCCTACTCCCCCAACACGGAAAACAAGGGCTCCCCCAAGCAAGCCAACCAAACCGTGGGCAAGGGCTTCTTCACCGCACCGGAGCGCACGGCAAGCGGCAAGCTCCAAC
GCACCCTCAGCACGACCTTCGAAGACAACTGGTCTCAGCCGCGCCTCTTCTGGAACTCCCTCGTCGACGCCGAGAAGCAATTCATCGTGGACGCGATGCGCTTCGAGACCTCGAACGTGA
AGAGCAGCGTGGTCCGCAACAACGTCATAATCCAACTGAACCGCATCAGCAACGACCTCGCCACTCGCGTCGCAAAGGCCATTGGCGTCGAGGCCCCCAAGCCCGACGACTCCTTCTACC
ACGACAACACGACCGCGCACATCGGCGCCTTCGGACAGAAACTCGCCAAGCTGGACGGTCTCAAGGTCGGACTCCTTGCGTCGGTGGATAAGCCTGCATCTATTGCGCAGGGCGCGAAAT
TGCAGTCTGCTCTTTCTTCTGCGGGCGTTGATGTCGTTGTTGTTGCGGAGAGAATGGCCGATGATGTTGATCAGACTTACTCTGCTTCTGACGCCGTGCAGTTCGATGCTGTTGTTGTTG
CTGATGGTGCCGAGGGTCTGTTTGGCGCTAAGTCTTTCACTACCCAGCCTACCAAGGGTTCCGGTGCGTCGACTTTGTACCCCGCTGGTCGGCCTTTGGATATCCTGCTCGACGCTTTCC
GGTTCGGTAAGACTGTTGGTGCGCTGGGTAAGGGCTCTGATGCTCTGCAGTCTGGACAGATTTCCTCCGAGCGTGAGGGTGTGTACACTGGCAAGGACGCTGGGGATGCCTTTGCCAAGG
ATATCAAGGAGGGCCTTAGCACCTTCAAGTTCTTAGATCGGTTTGCCGTTGACCAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGTCCTTGCCCTCGTCACGGGCCTTGTTGGCGTTGCCAATGCTGCCTGTCCTTATATGACTGGCGAGGCCGCCAATCCTCACATCGAGCGTCGCGCAGACGGAGATGCTGCTGCC
AACACCGAAGAATTCCTCTCCCAATTCTACCTCAACGACCAAGACGTCTATCTGACCTCCGACGTTGGTGGCCCGATCGAGGACCAAAACAGTCTCAGCGCAGGAGAGCGTGGAGCGACC
CTGCTCGAGGATTTCATTTTCCGCCAGAAGATCCAGCGCTTCGATCATGAACGA
GTACCGGAACGCGCCGTTCACGCTCGAGGCGCCGGCGCCCACGGAACATTCACCTCCTACGGTGAC
TGGTCCAACCTGACTGCCGCTTCTTTCCTTTCCGCCGAGGGCAAACAAACCCCAATGTTCACGCGCTTCTCCACCGTCGCTGGTAGCCGCGGAAGCGCTGACACCGCGCGAGACGTCCAC
GGCTTCGCGACTCGCTTCTATACCGATGAAGGAAACTTTG
ATATTGTTGGAAACAACGTTCCCGTTTTCTTCATCCAGGATGCCATCCTGTTCCCGGATCTCATTCACGCCGTCAAGCCC
CGTGGCGACAACGAGATCCCCCAGGCTGCTACCGCGCACGACTCCGCTTGGGATTTCTTCAGCCAGCAACCTAGCACACTTCACACCCTTCTGTGGGCAATGGCTGGCCACGGTATTCCC
CGTTCGTTCCGTCACGTTGATGGATTCGGTGTGCACACCTTCCGTTTGGTTACTGACGACGGAAAGACCAAGCTTGTCAAGTTCCACTGGAAGGGACTGCAGGGCAAGGCCAGCTTTGTC
TGGGAGGAGGCCCAGCAAACCGCTGGTAAGAATGCGGACTTTATGCGCCAGGACCTTTTCGAATCCATTGAGGCTGGACGTTTCCCCGAGTGGGAG
CTTGGTGTCCAAATCATGGAGGAA
GAGGACCAGCTTCGATTTGGATTTGATCTCTTGGACCCTACCAAGATCGTCCCTGAGGAACTCGTTCCTGTCACCATCCTGGGCAAGATGCAACTGAACCGCAACCCTATGAACTACTTC
GCCGAGACCGAGCAAGTCATG
TTCCAACCGGGCCACATCGTCCGCGGCGTCGACTTCACCGAGGACCCCCTCCTCCAGGGCCGTCTCTTCTCCTACCTCGACACTCAGCTCAACCGCCAC
GGTGGTCCCAACTTCGAGCAGCTCCCCATCAACCGTCCCCGCGCACCAATCCACAACAACAACCGTGACGGCGCAG
GCCAAATGTTCATCCCGCTGAACCCCAACGCCTACTCCCCCAAC
ACGGAAAACAAGGGCTCCCCCAAGCAAGCCAACCAAACCGTGGGCAAGGGCTTCTTCACCGCACCGGAGCGCACGGCAAGCGGCAAGCTCCAACGCACCCTCAGCACGACCTTCGAAGAC
AACTGGTCTCAGCCGCGCCTCTTCTGGAACTCCCTCGTCGACGCCGAGAAGCAATTCATCGTGGACGCGATGCGCTTCGAGACCTCGAACGTGAAGAGCAGCGTGGTCCGCAACAACGTC
ATAATCCAACTGAACCGCATCAGCAACGACCTCGCCACTCGCGTCGCAAAGGCCATTGGCGTCGAGGCCCCCAAGCCCGACGACTCCTTCTACCACGACAACACGACCGCGCACATCGGC
GCCTTCGGACAGAAACTCGCCAAGCTGGACGGTCTCAAGGTCGGACTCCTTGCGTCGGTGGATAAGCCTGCATCTATTGCGCAGGGCGCGAAATTGCAGTCTGCTCTTTCTTCTGCGGGC
GTTGATGTCGTTGTTGTTGCGGAGAGAATGGCCGATGATGTTGATCAGACTTACTCTGCTTCTGACGCCGTGCAGTTCGATGCTGTTGTTGTTGCTGATGGTGCCGAGGGTCTGTTTGGC
GCTAAGTCTTTCACTACCCAGCCTACCAAGGGTTCCGGTGCGTCGACTTTGTACCCCGCTGGTCGGCCTTTGGATATCCTGCTCGACGCTTTCCGGTTCGGTAAGACTGTTGGTGCGCTG
GGTAAGGGCTCTGATGCTCTGCAGTCTGGACAGATTTCCTCCGAGCGTGAGGGTGTGTACACTGGCAAGGACGCTGGGGATGCCTTTGCCAAGGATATCAAGGAGGGCCTTAGCACCTTC
AAGTTCTTAGATCGGTTTGCCGTTGACCAGTAA

Retrieve as FASTA