Entry information : NhaeKat01 (NhaeKatE1)
Entry ID 8419
Creation 2011-06-01 (Marcel Zamocky)
Last sequence changes 2011-06-01 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-24 (Catherine Mathe (Scipio))
Peroxidase information: NhaeKat01 (NhaeKatE1)
Name (synonym) NhaeKat01 (NhaeKatE1)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Nectria
Organism Nectria haematococca    [TaxId: 140110 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NhaeKat01
start..stop
S start..stop
GzKat01 1240 0 1..738 1..738
CheKat02_C5 1116 0 1..738 1..740
CheKat02_C4 1116 0 1..738 1..740
CgraKat01 1111 0 1..738 1..742
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 285547..285765 219 N° 2 283491..285488 1998  
complement(join(283491..285488,285547..285765))


exon

Literature and cross-references NhaeKat01 (NhaeKatE1)
Literature Coleman JJ, Rousnley SD, Rodriguer-Carres M et al. (2009) The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion. PLoS Genet. 5:E1000618
Protein ref. GenBank:   EEU39898.1 UniProtKB:   C7Z7W7
DNA ref. JGI genome:   sca_19_chr4_3_0 (285765..283491)
EST ref. GenBank:   GE241617.1   GE241618.1
Protein sequence: NhaeKat01 (NhaeKatE1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   738
PWM (Da):   %s   82689.61  
PI (pH):   %s   6.33
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSEKIIGSIKHAVMGSKSDKIDQLKTTTVEPDENSRITSDFGTKQSNTDNWLRVNREDQTGPMLLEDTFGREKIHRFDHERIPERVVHARGAGAFGTFRLHESAEDVTHAGILTDTSRETPLFVRFSTVLGSRGSADTVRDVRGFAVKFYTPEGNWDIVGNNIPVFFIQDAIKFPDLIHAGKPEPHNEVPQGQSAHNNFWDFVYMHSEATHMYFWTMSDRAIPRSFRMMQGFGVNTYTLINAKGEKHFVKFHFTPELGVHSLVWDEALKLAGQDPDFHRKDLWEAIENGAYPKWKFGIQTIPESKEHDFDFDVLDATKVWPEDLIPVRYIGELELNRNVDEYFTQTEQVAFCTSHVVPGIGFSDDPLLQGRNFSYSDTQLSRLGINWQELPINRPVCPVMNFNRDGAMRHTIAKGKVNYWPNRYGYQPAATKEEGGYIDYPQKVQGIKERALSAKFKDHTSQAQLFYNSLSEPERAHLRAAFSFELDHCDEAIVYERLTQRLSEVDGVLAGLVADMVGGEKPQGGKQNPGKTAKNLSQMDFLPGTPTIATRRVGIIIADGYDPIAFNAVYGAIKAQNAIPLVLAPRRSAIFSADENPDTSKGIVPDHHLEGQRSTMFDALFIPGGERSIQTLAKIGRARHYIREAFGHLKAIGGTGEGVQLIENAIQLPEVSLSEADNGNVVESYGVVTLRNARPESLKEIVSVAKNAKGFLEQFVYAISQHRCWQRELDGLNAMVAY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 1 intron) and 2 ESTs. Strain="77-13-4/FGSC 9596".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGAGAAAATAATTGGGAGTATCAAACACGCAGTCATGGGTTCCAAGAGCGACAAGATTGATCAGCTCAAGACCACCACGGTCGAGCCTGACGAAAATTCGAGAATTACTTCCGAC
TTTGGTACCAAACAGAGCAACACGGATAACTGGCTGCGGGTGAATAGGGAGGATCAGACGGGACCTATGCTCTTGGAGGACACATTTGGCCGCGAGAAG
GTATGATTCCAACGATGTTGA
GATACTACTTGGACAAATGTTTACCAGGAAGTGCTAGATCCACCGCTTTGATCATGAACGTATCCCCGAGCGGGTCGTCCACGCCCGTGGGGCCGGCGCTTTCGGAACCTTTAGACTCCA
CGAGTCGGCCGAGGACGTAACCCACGCCGGCATCCTCACCGACACCTCTCGCGAGACGCCCCTCTTTGTCCGCTTCTCCACCGTCCTCGGCAGTCGAGGCTCTGCAGACACAGTCCGCGA
TGTCCGTGGCTTTGCGGTCAAGTTCTACACCCCCGAGGGAAACTGGGATATCGTGGGTAACAATATCCCCGTCTTCTTCATACAAGATGCTATCAAGTTCCCCGACTTGATCCACGCTGG
AAAACCTGAGCCGCATAATGAAGTACCCCAAGGACAGTCAGCACACAACAACTTTTGGGACTTTGTATACATGCACTCCGAGGCAACACACATGTACTTCTGGACCATGTCCGACCGAGC
CATCCCGCGTTCCTTTCGCATGATGCAAGGTTTTGGCGTCAATACCTACACTCTCATCAACGCAAAGGGAGAGAAGCACTTTGTTAAGTTTCATTTTACTCCAGAGCTGGGCGTCCACTC
TCTCGTCTGGGATGAGGCCCTGAAGCTCGCTGGCCAAGATCCTGATTTCCACCGCAAGGATCTCTGGGAGGCCATTGAGAATGGGGCGTATCCTAAGTGGAAGTTTGGTATCCAGACCAT
CCCCGAGTCCAAGGAGCACGACTTTGACTTTGATGTTCTCGATGCCACTAAAGTCTGGCCCGAGGACCTCATCCCCGTCCGTTACATCGGCGAACTGGAGCTCAACCGGAACGTCGACGA
GTACTTTACCCAGACTGAGCAGGTCGCCTTTTGCACCAGTCATGTGGTTCCTGGCATTGGGTTCTCCGATGACCCTCTTCTTCAAGGCCGGAACTTTTCCTACTCGGATACTCAACTCAG
CAGACTTGGCATCAATTGGCAGGAGTTGCCCATCAACAGACCAGTATGCCCTGTCATGAACTTTAACCGCGACGGTGCTATGCGACATACAATTGCCAAGGGCAAGGTCAATTATTGGCC
AAACAGATATGGTTATCAGCCAGCGGCAACTAAGGAAGAAGGTGGATATATCGACTATCCTCAAAAAGTTCAAGGGATCAAAGAGCGAGCTTTGAGTGCTAAGTTCAAGGACCACACCTC
ACAAGCCCAGCTGTTTTACAACTCGCTCTCCGAGCCGGAGAGAGCACATCTTCGAGCAGCTTTTTCGTTCGAGCTGGACCATTGTGATGAGGCAATTGTGTACGAACGACTAACTCAGCG
ATTATCAGAGGTAGATGGCGTACTTGCAGGGCTTGTCGCAGACATGGTCGGGGGCGAGAAGCCACAAGGCGGTAAGCAAAACCCCGGAAAGACGGCCAAGAATCTCAGTCAGATGGACTT
TCTCCCCGGGACTCCTACTATTGCAACTCGGCGTGTTGGTATCATCATCGCAGACGGTTACGATCCCATCGCCTTCAACGCAGTCTACGGAGCCATCAAGGCTCAAAACGCCATTCCTCT
TGTTCTTGCACCGCGTCGTTCAGCTATTTTCTCAGCAGATGAGAACCCAGACACTTCCAAAGGCATCGTTCCTGACCACCACCTCGAAGGCCAACGGAGCACCATGTTTGACGCCCTATT
CATCCCGGGGGGTGAAAGGTCTATACAGACGCTTGCCAAGATCGGCCGTGCCCGGCACTACATTCGCGAAGCCTTTGGCCACCTCAAGGCAATTGGTGGTACCGGGGAAGGTGTTCAGTT
GATTGAGAATGCGATCCAGCTCCCCGAGGTTTCCCTCTCAGAGGCCGATAACGGTAATGTGGTGGAGAGCTACGGAGTTGTGACGCTCAGGAACGCGCGGCCCGAGAGTTTGAAGGAGAT
TGTTAGTGTTGCAAAGAACGCAAAGGGCTTTTTGGAGCAGTTTGTGTATGCTATTAGCCAGCATCGTTGCTGGCAGCGAGAGTTGGACGGGCTGAATGCCATGGTGGCATATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGAGAAAATAATTGGGAGTATCAAACACGCAGTCATGGGTTCCAAGAGCGACAAGATTGATCAGCTCAAGACCACCACGGTCGAGCCTGACGAAAATTCGAGAATTACTTCCGAC
TTTGGTACCAAACAGAGCAACACGGATAACTGGCTGCGGGTGAATAGGGAGGATCAGACGGGACCTATGCTCTTGGAGGACACATTTGGCCGCGAGAAG
ATCCACCGCTTTGATCATGAA
CGTATCCCCGAGCGGGTCGTCCACGCCCGTGGGGCCGGCGCTTTCGGAACCTTTAGACTCCACGAGTCGGCCGAGGACGTAACCCACGCCGGCATCCTCACCGACACCTCTCGCGAGACG
CCCCTCTTTGTCCGCTTCTCCACCGTCCTCGGCAGTCGAGGCTCTGCAGACACAGTCCGCGATGTCCGTGGCTTTGCGGTCAAGTTCTACACCCCCGAGGGAAACTGGGATATCGTGGGT
AACAATATCCCCGTCTTCTTCATACAAGATGCTATCAAGTTCCCCGACTTGATCCACGCTGGAAAACCTGAGCCGCATAATGAAGTACCCCAAGGACAGTCAGCACACAACAACTTTTGG
GACTTTGTATACATGCACTCCGAGGCAACACACATGTACTTCTGGACCATGTCCGACCGAGCCATCCCGCGTTCCTTTCGCATGATGCAAGGTTTTGGCGTCAATACCTACACTCTCATC
AACGCAAAGGGAGAGAAGCACTTTGTTAAGTTTCATTTTACTCCAGAGCTGGGCGTCCACTCTCTCGTCTGGGATGAGGCCCTGAAGCTCGCTGGCCAAGATCCTGATTTCCACCGCAAG
GATCTCTGGGAGGCCATTGAGAATGGGGCGTATCCTAAGTGGAAGTTTGGTATCCAGACCATCCCCGAGTCCAAGGAGCACGACTTTGACTTTGATGTTCTCGATGCCACTAAAGTCTGG
CCCGAGGACCTCATCCCCGTCCGTTACATCGGCGAACTGGAGCTCAACCGGAACGTCGACGAGTACTTTACCCAGACTGAGCAGGTCGCCTTTTGCACCAGTCATGTGGTTCCTGGCATT
GGGTTCTCCGATGACCCTCTTCTTCAAGGCCGGAACTTTTCCTACTCGGATACTCAACTCAGCAGACTTGGCATCAATTGGCAGGAGTTGCCCATCAACAGACCAGTATGCCCTGTCATG
AACTTTAACCGCGACGGTGCTATGCGACATACAATTGCCAAGGGCAAGGTCAATTATTGGCCAAACAGATATGGTTATCAGCCAGCGGCAACTAAGGAAGAAGGTGGATATATCGACTAT
CCTCAAAAAGTTCAAGGGATCAAAGAGCGAGCTTTGAGTGCTAAGTTCAAGGACCACACCTCACAAGCCCAGCTGTTTTACAACTCGCTCTCCGAGCCGGAGAGAGCACATCTTCGAGCA
GCTTTTTCGTTCGAGCTGGACCATTGTGATGAGGCAATTGTGTACGAACGACTAACTCAGCGATTATCAGAGGTAGATGGCGTACTTGCAGGGCTTGTCGCAGACATGGTCGGGGGCGAG
AAGCCACAAGGCGGTAAGCAAAACCCCGGAAAGACGGCCAAGAATCTCAGTCAGATGGACTTTCTCCCCGGGACTCCTACTATTGCAACTCGGCGTGTTGGTATCATCATCGCAGACGGT
TACGATCCCATCGCCTTCAACGCAGTCTACGGAGCCATCAAGGCTCAAAACGCCATTCCTCTTGTTCTTGCACCGCGTCGTTCAGCTATTTTCTCAGCAGATGAGAACCCAGACACTTCC
AAAGGCATCGTTCCTGACCACCACCTCGAAGGCCAACGGAGCACCATGTTTGACGCCCTATTCATCCCGGGGGGTGAAAGGTCTATACAGACGCTTGCCAAGATCGGCCGTGCCCGGCAC
TACATTCGCGAAGCCTTTGGCCACCTCAAGGCAATTGGTGGTACCGGGGAAGGTGTTCAGTTGATTGAGAATGCGATCCAGCTCCCCGAGGTTTCCCTCTCAGAGGCCGATAACGGTAAT
GTGGTGGAGAGCTACGGAGTTGTGACGCTCAGGAACGCGCGGCCCGAGAGTTTGAAGGAGATTGTTAGTGTTGCAAAGAACGCAAAGGGCTTTTTGGAGCAGTTTGTGTATGCTATTAGC
CAGCATCGTTGCTGGCAGCGAGAGTTGGACGGGCTGAATGCCATGGTGGCATATTAA

Retrieve as FASTA