Entry information : TgKat01 (TgKatE)
Entry ID 8428
Creation 2011-06-16 (Marcel Zamocky)
Last sequence changes 2011-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-11 (Christophe Dunand)
Peroxidase information: TgKat01 (TgKatE)
Name (synonym) TgKat01 (TgKatE)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Apicomplexa Coccidia Sarcocystidae Toxoplasma
Organism Toxoplasma gondii    [TaxId: 5811 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TgKat01
start..stop
S start..stop
TthKat01 681 0 15..493 9..482
PtetKat01 626 0 15..493 8..482
CowKat01 621 0 16..497 4..483
NgrKat01 620 0 12..492 9..486
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..117 117 N° 2 618..677 60 N° 3 868..935 68 N° 4 1574..1969 396
N° 5 2836..3007 172 N° 6 3648..3903 256 N° 7 4688..4911 224 N° 8 5546..5650 105
N° 9 5993..6103 111  
join(1..117,618..677,868..935,1574..1969,2836..3007,3648..3903,4688..4911,5546.. 5650,5993..6103)


exon

Literature and cross-references TgKat01 (TgKatE)
Literature Ding M., Clayton C., Soldati D. (2000) Toxoplasma gondii catalase: are there peroxisomes in toxoplasma? J. Cell. Sci. 113, 2409-2419.
Protein ref. GenBank:   AAD45528.2 UniProtKB:   Q9XZD5
DNA ref. GenBank:   AF161267.1 (259..6361)
mRNA ref. GenBank:   AF136344
Protein sequence: TgKat01 (TgKatE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   502
PWM (Da):   %s   57103.22  
PI (pH):   %s   7.07
Sequence 543
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTQVPPVTFQQYGPVITTSAGNPVDDNQNSVTAGPYGPAILSNFHLIDKLAHFDRERIPERVVHAKGGGAFGYFEVTHDITRFCKAKLFEKIGKRTPVFARFSTVAGESGSADTRRDPRGFALKFYTEEGNWDMVGNNTPIFFVRDAIKFPDFIHTQKRHPQTHLHDPNMVWDFFSLVPESVHQVTFLYTDRGTPDGFRHMNGYGSHTFKFINKDNEAFYVKWHFKTNQGIKNLNRQRAKELESEDPDYAVRDLFNAIAKREFPSWTFCIQVMPLKDAETYKWNVFDVTKVWPHGDYPLIPVGKLVLDRNPENYFQDVEQAAFAPAHMVPGIEPSEDRMLQGRMFSYIDTHRHRLGANYHQIPVNRPWNARGGDYSVRDGPMCVDGNKGSQLNYEPNSVDGFPKEDRNAAVSGTTTVSGTVACHPQEHPNSDFEQPGNFYRTVLSEPEREALIGNIAEHLRQARRDIQERQVKIFYKCDPEYGERVARAIGLPTAACYPAKM

Retrieve as FASTA  
Remarks complete from genomic (8 introns). Strain="RH".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACTCAGGTTCCGCCCGTAACATTCCAGCAGTATGGACCGGTTATCACGACCTCTGCTGGGAACCCAGTCGATGACAACCAAAACTCGGTAACTGCTGGACCCTACGGCCCCGCGGTAA
GCAAGAGAGAATCTGTGATGCGTCCGGTACTGGAATCAGTCACAATGAGTAGATGTATTCTCATAGGAAGAGAGGAGGATGTTATGTGAAGTACCCACACAAGCATCATGCACGTTTCTG
CCTTCGTTGCAGCAGCGTTCTCTTCACGTACGTACATATCCGTGTGTCTTTGGGTTGCTGTGCCGTTCCTTTCTGCTTCCCACTCACCACATACAAACATGTTGCTACGTTGGCTCTGCC
AAATTTATATCGCGCGAGAATTATTTCTTCTCTCAGTTGTGCGAGCTGCGTCTTTGCTTAGGACTGGACGTACCCAGGCAACCTTGCCCTGTCTCGTGCCGACATGACACTGTGGTTCTG
CTTCTGTTTTAGCTCAGGGGCAATCGCTGCGTTTGCTGTTCATTTAGCAACGCTTGCCTGCACAGCATTGGCAGTCATAGAAGCCATATTTTCGCGCGTTGCTCTGCGGTTCCTTTTGTC
ACTGCACTACGCGTAGATCCTGAGTAACTTCCATCTCATCGACAAGCTGGCCCACTTCGATCGAGAACGCATTCCCGTAAGTGTCGCTTTCTGTAATCTCCATACCAGGGATGATCTCTA
CAGAATTCAAGATCGACAAAGAGAACAAAAGAGTCGGTGGGGGAGCCGCGTCACTCGTGCGCGTTATTTTTTTCCATTTGTGAATACACTTCTCCGGATTTAGTACTCACCTTGTTCTGG
GTTCACGTGAGTTGTGCTCTGTGCAGGAGCGCGTTGTGCATGCCAAGGGCGGTGGCGCCTTTGGCTATTTCGAGGTCACTCATGACATCACCAGGTGAGCTGATTTTGTTCCTCCCCAAC
TGTTGTTACCGTTTCTCTCTTGAAAGAAACGGTTGAGTGTCTGCAATTTTAACATCGTGTCGAAATTTCTTTCGTTTCGCTACGAAACCACCACGTATGTTTTATGGTCATACCTCGGTG
AGAGTGTGCATCGTACATGTCTTCGGTTATATGCCTATATGCATATATATATATATATATATAACTGCATTAACAGGAAACGCTGAGTGTGTACGTATTAGTGAGTGATCGCTTGATTGT
CTCGGTTCATGGTCCTCCGCTCCGTTTGCCGGTTTCGTGCGTTGGCGCAGTTTCTGAATTTCTTACCTTTGTTCCCGGTTGATCGGATACTCTCTCCTATTTTATCACCGTTTGTCGCCG
GCTCGCTTTCTTGAGCCTTCTGCGCCCATGTCCAGTTTTTTCACTCTTTACATTCGTGTCTCTTCGCTTTCTATGTTTCGCTTCGTTCCTTAAGCTTCGCTTATTCTCCCAAATGTTCTC
CTTGTTCTGCCTCTGGATACTTGGATTTTTTCCTTTCCACCGTCCGCGGCTATCGGCTGTCGCTTAAGTTTTTAACTTCGTTCTCACCCATTCCTGTTTCCTGTCGGTACATCGCCTCTC
TTCGTTCGTCAGATTCTGCAAAGCGAAGCTGTTCGAGAAAATCGGAAAGCGGACGCCTGTGTTTGCACGTTTTTCGACGGTGGCTGGCGAGTCGGGGAGTGCGGACACCAGGCGCGACCC
GCGCGGCTTCGCACTCAAGTTCTACACGGAGGAGGGGAACTGGGACATGGTTGGAAACAACACTCCTATCTTTTTCGTTCGAGACGCCATAAAGTTCCCCGACTTCATTCATACGCAGAA
GCGGCATCCGCAAACGCACCTCCACGACCCGAACATGGTGTGGGATTTCTTCTCGCTCGTTCCGGAAAGTGTGCATCAAGTGACCTTCCTGTACACGGACCGTGGCACACCGGACGGCTT
CCGCCATATGAATGGCTACGGGAGTCACACGTTCAAATTCATCAACAA
GTAGGACTCAGAAAGCTCGAGAAGTGAACGTGAAGAGAACCTTCCACGTACTCAGACGCATCAATATGTCCA
GCTATGTGCATTTTTCTCGACAAGGATAAACTTTTGCGTCCATGGCTGCTTATTCGCGTCCACACACACCCGTTCCGATTATCAGGTTCCAGCGATATCTGTGCAAATGTATTTATTTGT
GCTCGTTCTCTGTGCATGTCGGTTCGATATATCTGTGCCCATCGTTATCTGAGGGAGTCGTTGTGGGAGCCTACCTAGGACAGTGAATAAGTCCGTACATGTGAATGCCTGCATAAACGC
AGAGGATTCTTTAATTTTCTTCGATCTGTACACACCAACGCATTCGTAAGAAGTGGTGTACGCGTTCGCGTGTTGGGGCATCCGTATGTCATTCGGGCTACTTCCTTGCGCACGGGTTAC
GTATGTGTCTCCCCCGTGAAAAGCAGTTCCATACATGCATATACATAAAATGCACATATACGGTTGCTGAGGCAAACTTACTTGCTTGTCTTCCTGTTACACTTGCTGAGATTTGCATCT
CGAACGTCTGGAGGCTGAGACTATCTCTATGCGTTCCACCAGTTTTCTGTTTCTCCTCCCGTTCGGCCGGGTGCGGCTGTCTTTTGAGTGTCTTGGTTACATTGCAAAGATGTTTTGCGC
CGCTTAATCTACATAACCAAGAACACACAGAACTTACACACAAAGAACACCTGGATTACCACTGACTGTTCCGCGGCCTACTCCTTCCCCCGCTTTACTGTGGCGCGGCGCACTACAGTG
CCCGCCGAGCTGTGTCTTCTTGACTTTCACGGTTTCCATTGTGTCTCTTTCGCCTGATGCTTGTACTGAAACAGAGACAACGAAGCCTTTTATGTCAAGTGGCACTTCAAGACAAACCAA
GGAATCAAGAACCTGAACAGACAGCGCGCAAAAGAACTCGAGAGCGAAGATCCTGACTACGCGGTTCGTGACCTGTTCAACGCCATTGCCAAGCGAGAGTTTCCCTCTTGGACCTTCTGT
ATTCAG
GTAGAGAACGGATACCAATTTCTCGTGGATCTTGAAAACCACGTAATTTCTCTGTATCAAATGGTCTCAAAGAGTTCCCCGCGAATCTTCTGCAACACGGTGGCTTCTCAGTGC
GTGATGGTCCTTAGTTGTTGCCTGATTCCGTATCTAGTGCGGACCACTGCCACTTTCCCGCTATCCCACTTGATCATTCTCTTTGGACAAGAGCGTTGTCTAGAAAACCACGCCGATTAA
CGGGTTTTATTGGCCGGTTTCAAGTCAATTCTTGAAGAATTAAGATGTCTGTGTCGTTATTTGTAATCCGCGTTGGGGGAATCGCGCAGAATGCTCCGCTCTAGGTTCACGGAACTATGA
GGGTGTCAAAGTGAAAGGCGGCGTTCTAGGCGGTTCCCATGTTTGTGGATAAATGAATGGATTTAGCTCTTTAAGGCATGTAGCTCCATTTTTCATTCTCTGTTCAACGGAGCAGGGAAG
TCCGGATGACATCAATACATTCAGCGAGACAGGTCGAAAGCTGTCCCGGTGTGGTGCGTTTGTCGATTTACGTTGATCCCCCCTGGTGGGTACGCTTGTACGTCCACATGTGCATAGGTG
TATGTGTGCATTAAACTTTTGTCGTTGGCGTGTGATTCGTTTTTAGGTAATGCCCTTGAAAGATGCAGAGACGTACAAATGGAATGTCTTTGACGTGACCAAAGTGTGGCCGCACGGCGA
CTACCCACTCATCCCGGTCGGAAAACTCGTGCTGGATCGCAACCCAGAAAACTATTTCCAAGACGTGGAACAAGCAGCTTTTGCGCCAGCTCATATGGTGCCAGGGATTGAACCGAGCGA
AGATCGCATGCTGCAGGGACGCATGTTCTCCTACATCGACACTCATCGGCACAGACTTGGCG
GTAAGGCTCTGAGACGCGGGCAAGCTCAGAGTTTTACGAACGATTTTCACGGCGTCTT
CAGCGCCCGACGGTCTCTGCTTTTAAACGTTGTTTCTCTGCACCTGGCTCTCATATCTGCATGCCGCTTCCCCACTCCGCGTCGTCTCCCCTTTTTTCACTGACGGTTGCCAGCGATCTC
GTGTACACTCCCCCCTTCCGTTTCTCTTGTACTCTTTTAGTATGTTTCTCTCTTTGTGGCTGCCCCCCCGTCGTCGCTCTCTCGGTTGAGTGTCTTCCTTCCATCTGCTTTATACTTACT
GTCTTCTTGATTGCTCACGAGGGGTCACAACAGGTCTTGTGTGTCCCTGCAACTGGCATAGCCACCGAAACCGTTTCCCGCGGCGAGTCCTAAGCCTTTGAGGCACCGGGTCTCTCTCTG
GACGCAGTGGAGAGAATGGGTTTGGAGGGTTTGTACGGACCGCAAACGCGTGCCTTTGGGGGCCAGCGTCTTTTTGCGTTTGAATAACGACGCAGACTTTGCACCGGGGGTTTTGAACAA
AGTCTGACATTCCTCCCAGCATCCATCATTTGTTTCAACTTCATTACAGCGAATGGTGCTCAGAAATACATGCGCCGACCGTGTGCATTTCGAAACAAACTGAGGTTGGAACAGTGCGTC
CAGCTGTATGCTACCCTCACATGGGGAGGTGCCCACTCTCAGACGCGTGGATGCGGATCTGTTTGATTTTACTTCGTTTCCCTGTTTGATGTTAGTCCTTTGCCCCCTTTTTGCTGTTTC
TCACAGCCAATTACCATCAGATTCCTGTGAACCGCCCGTGGAACGCCCGTGGGGGCGACTACTCCGTCCGCGATGGTCCAATGTGCGTCGACGGGAACAAAGGGTCTCAGCTGAATTACG
AACCGAACAGTGTGGACGGTTTTCCAAAGGAAGACAGAAATGCTGCTGTGTCGGGAACGACCACAGTGAGTGGCACGGTCGCGTGCCATCCTCAAGAGCACCCCAACAGT
GTAAGCCAGA
GAGGGAAGCGTATCCGTGTTGGCCCATCTTTATATTTGCTTGTCGAACGAGTCGAGCACCTCTGCGTAAAAGCTGCCAGCAAGCGACGACGTTCCACAGCGCATCTGGGGGCCGGTGTTA
CAGAGTCATCTAGGTGGACGCTGGTCGCAGTGGCAGTTTTCACAAGCAGAGAGAATGCAGGGTGTCTGTGAGGAGCTGCTCAGTTATTCTTGGCGGAGAGACAGAGACCCCTGGAAAAGA
AATGAAACGAGTGTCTCTGCAATGTCTTCACATGAAAGATAAACATTTTTTCTCTTTTCCTAATGAGCCCGAACTGGCAGCACTCGCCACGACATTACACATATTTAGACACTATTGCGA
GGACACATTCATATGTATATATGTATATATATATATATGTAAGTATATATATATATATATATATGATTTTAAAATCTAGATGTGCGAGCATTCAAGGTTCAAATTGCTTATGCTTACATA
CGTGCGTCTATATACAGTGCATGCCTGTAGTTGTGAATTCGTCTATGAACATGCAAGTAGACATTTTCGAGGAAGGCCATTCTGAGAGTTTTGATGTATAACCAAAACAGTATTGATTGG
TTTCCTCCGCATTTTTTCCGACAGGACTTTGAGCAGCCAGGGAACTTTTATAGAACGGTCTTGAGTGAGCCGGAGAGGGAAGCGCTCATTGGCAACATCGCCGAGCATCTCAGGCAGGCG
AGACGAGAT
GTAAGCAAGTACATCCACTAGCGTGTATTCTTCTGTCCGTGGTGGTACCGACGTGCTTTATCGTATGACGATAGACTCATAGCGTGTCCAGGCTTTCTTCCTAGATCCGTT
GCCTTCCTCTGTCACTCGAGCTACAGAGTTGGAACAGAACTTGGACGTCAGGCCAACCTTCCATCGATCAGGTCTCTGAGCTGGCACACATTTGCGTTCCACACTGTTCAACTCTTTAGA
CGATCGTAGATTACAGACACGTAGGAATCCCGTTTTATACTATGGAAGAGGGAGTGCAGCTGCAGGAATTTTACGATTGCCGCTCTCTGATTTGTCTTAACGCTGTCGCAGATTCAAGAG
CGACAGGTGAAGATTTTTTACAAGTGCGATCCAGAGTATGGCGAGCGCGTCGCTCGAGCCATCGGTTTGCCGACTGCGGCGTGCTACCCAGCCAAGATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACTCAGGTTCCGCCCGTAACATTCCAGCAGTATGGACCGGTTATCACGACCTCTGCTGGGAACCCAGTCGATGACAACCAAAACTCGGTAACTGCTGGACCCTACGGCCCCGCGATCC
TGAGTAACTTCCATCTCATCGACAAGCTGGCCCACTTCGATCGAGAACGCATTCCC
GAGCGCGTTGTGCATGCCAAGGGCGGTGGCGCCTTTGGCTATTTCGAGGTCACTCATGACATCA
CCAG
ATTCTGCAAAGCGAAGCTGTTCGAGAAAATCGGAAAGCGGACGCCTGTGTTTGCACGTTTTTCGACGGTGGCTGGCGAGTCGGGGAGTGCGGACACCAGGCGCGACCCGCGCGGCT
TCGCACTCAAGTTCTACACGGAGGAGGGGAACTGGGACATGGTTGGAAACAACACTCCTATCTTTTTCGTTCGAGACGCCATAAAGTTCCCCGACTTCATTCATACGCAGAAGCGGCATC
CGCAAACGCACCTCCACGACCCGAACATGGTGTGGGATTTCTTCTCGCTCGTTCCGGAAAGTGTGCATCAAGTGACCTTCCTGTACACGGACCGTGGCACACCGGACGGCTTCCGCCATA
TGAATGGCTACGGGAGTCACACGTTCAAATTCATCAACAA
AGACAACGAAGCCTTTTATGTCAAGTGGCACTTCAAGACAAACCAAGGAATCAAGAACCTGAACAGACAGCGCGCAAAAG
AACTCGAGAGCGAAGATCCTGACTACGCGGTTCGTGACCTGTTCAACGCCATTGCCAAGCGAGAGTTTCCCTCTTGGACCTTCTGTATTCAG
GTAATGCCCTTGAAAGATGCAGAGACGT
ACAAATGGAATGTCTTTGACGTGACCAAAGTGTGGCCGCACGGCGACTACCCACTCATCCCGGTCGGAAAACTCGTGCTGGATCGCAACCCAGAAAACTATTTCCAAGACGTGGAACAAG
CAGCTTTTGCGCCAGCTCATATGGTGCCAGGGATTGAACCGAGCGAAGATCGCATGCTGCAGGGACGCATGTTCTCCTACATCGACACTCATCGGCACAGACTTGGCG
CCAATTACCATC
AGATTCCTGTGAACCGCCCGTGGAACGCCCGTGGGGGCGACTACTCCGTCCGCGATGGTCCAATGTGCGTCGACGGGAACAAAGGGTCTCAGCTGAATTACGAACCGAACAGTGTGGACG
GTTTTCCAAAGGAAGACAGAAATGCTGCTGTGTCGGGAACGACCACAGTGAGTGGCACGGTCGCGTGCCATCCTCAAGAGCACCCCAACAGT
GACTTTGAGCAGCCAGGGAACTTTTATA
GAACGGTCTTGAGTGAGCCGGAGAGGGAAGCGCTCATTGGCAACATCGCCGAGCATCTCAGGCAGGCGAGACGAGAT
ATTCAAGAGCGACAGGTGAAGATTTTTTACAAGTGCGATCCAG
AGTATGGCGAGCGCGTCGCTCGAGCCATCGGTTTGCCGACTGCGGCGTGCTACCCAGCCAAGATGTAG

Retrieve as FASTA