Entry information : PtAPx10 (POPTR_0005s17350 / Potri.005G161900)
Entry ID 8470
Creation 2011-08-18 (Christophe Dunand)
Last sequence changes 2011-08-18 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-11-28 (Qiang Li)
Peroxidase information: PtAPx10 (POPTR_0005s17350 / Potri.005G161900)
Name (synonym) PtAPx10 (POPTR_0005s17350 / Potri.005G161900)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtAPx10
start..stop
S start..stop
CclAPx01 577 0 1..347 1..349
MeAPx02 575 0 1..347 1..349
CpapAPx06 560 0 1..347 4..347
VvAPx07 559 0 1..347 1..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14664645..14664740 96 N° 2 14664439..14664537 99 N° 3 14663965..14664049 85 N° 4 14663847..14663881 35
N° 5 14663648..14663713 66 N° 6 14663496..14663536 41 N° 7 14662938..14663068 131 N° 8 14662685..14662791 107
N° 9 14662196..14662333 138 N° 10 14661934..14662068 135 N° 11 14661631..14661741 111  
complement(join(14661631..14661741,14661934..14662068,14662196..14662333,1466268 5..14662791,14662938..14663068,14663496..14663536,14663648..14663713,14663847..1 4663881,14663965..14664049,14664439..14664537,14664645..14664740))


exon

Literature and cross-references PtAPx10 (POPTR_0005s17350 / Potri.005G161900)
DNA ref. Phytozome 12:   scaffold_5 (14664740..14661631)
Omic ref. ePlant:   Potri.005G161900
Protein sequence: PtAPx10 (POPTR_0005s17350 / Potri.005G161900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348
PWM (Da):   %s   37849.34  
PI (pH):   %s   7.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGASFLSTLPSLVSVPSLTISTTPTIRCPSHAVAIRCHKMDTDVPGENVLRRREVLKCFGATVGMELLASSGSFVEMASAADLIQRRQRSEFQSSIRQTLFAAIKGKPELVPYILTLALNDAITYDKATKSGGPNGSIRFSSEISRPENKGLSAALNLIEEAKEEIDSYSKGGPISFADLIPYAGQSAVKATFLASAIRKCGGNEQKGSLLYSAYGSSGQWGLFDRQFGRTDSQEPDPEGRVPQWEKATVQEMKDKFSSIGFGPRQLAVMSAFLGPDQAATEALLATDPDVTPWVQKYQRSRETVSQTDYEVDLITTLTKLSSMGQQINYEAYTYPVRKIELSKLKL*

Retrieve as FASTA  
Remarks Complete sequecne from genomic and 8 ESTs. Incorrect prediction from Phytozome (first intron is not predicted)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGCTTCTTTCCTATCAACCCTCCCCTCTTTGGTTAGTGTCCCTTCTTTAACCATCTCTACTACTCCTACCATTAGATGTCCTTCTCATGCTGTAAGTTCTCTTGAAATGTTGCTT
CAGTTTCATCTTGGCTGGGAATGCTACAGAAAATGGAATCATTTATTTTTCTCTCTTTTGCCTTTTGGCTAAATATTGATCAGGTCGCAATTCGTTGTCATAAAATGGACACTGATGTCC
CTGGTGAGAATGTTCTACGTCGAAGAGAAGTTTTGAAATGCTTTGGTGCTACTGTTGGCATG
GTAAGAGAGAAATAACACTTCCCTTTCATTGCTCAAGGATTTGGCATTCACATTCTAT
GCAAACTTGACCATCCACTTCTTGATTCTATTTCAAAGGAGATACATTAGTGTGTTGTTTTGGTATACATGGTCAGATGACACTAATCCTACATTCGAAACATTGTTGATTTATGAGATA
TACAATTTAATTGCCTTTTTTTTTCCCGCTCAGAAAAAAATATAAATAAAAAGGGGATATCTGAAATATTTCAGTTATAATATTCTCTCATTTTGATTTTGTGGAATGTTGATGTTAATG
GTTGTATTTTGACGCATCCTTTATATATTGGAAATCCATAATGTAGAATGATGTGATGATGAGTTTCTAACCTGTTTTGCTGTAAACTTAGGAATTGCTAGCAAGCTCAGGATCATTTGT
TGAAATGGCTAGTGCTGCTGATTTGATCCAACGCAGGCAGCGTTCTGAGTTTCAGT
GTGAGTTCCCTAATCTCAACATTTCCAAGCATGCTCAATCAGCTACAGTTTGCTCAGTTGATGT
TGCATCTTCTTTCTCACAGCCAGCATAAGGCAGACCCTTTTCGCAGCTATAAAGGTGAACCACACAACCTTGCCTTTATGCTATCTTTTTATCAAGTAGTTGTTCTGCAGTTCTATAAAA
TGGATAGAAATATCTACATCGTGCTTTGATGGTTTTTTGATCACTATTCCGTTGATATTTGTTTCAGGGCAAACCTGAACTTGTACCATACATTCTAACTCTGGCTCTGAATGATGCCAT
TACTTATGATAAG
GTCAGACAAATTCCTTCACCTGTTGAATTCCTATATGATTGCTATGGAAGTCCTTAACTAAAGGTAAAAGTCGAAAGAAATGCGCTGATTAATTCCTGATTAAGTTT
GCAGGCTACAAAATCTGGGGGCCCAAATGGATCCATACGATTCAGGTATTTCAGTTATGAAGTTATCATCTTTTATGAGTTTGTACACTGATTTATCAATGTGTGAAAGTTTACACTTTC
CTCTTCCTCTAGCATGTAGAGAAACTGGGTCTCATACATTTGCATACGCACTGCAAGCATCAACTCCCAATTGATTATGATTATTCACTGAGGAATGAGCAAATAGAACCTCCTACAGGT
TCTTTGTGAAGCATCCTGTCAGCACGCTTATATCACGATCTGTGATGTTCGCTGTTCCTGGTTTTTGGATGCTTAAGTAAATTAGAACACCTGCTTAGGTTGCAGAATTGTAAATTATTG
TCTGAAGTAATCCCTGCTTCTTGATTGAAGTCCCTTTTGCTTTTTGAAGCAATAACTTACCTCCTTGCCTGAATGTTGTCTTAATTTTCTTCTCCTTTTTTCCCACCTGAAGTTCAGAGA
TAAGCAGACCTGAAAATAAGGGACTTTCTGCCGCGTTGAATTTAATAGAGGAAGCGAAGGAGGAGATTGATTCATATTCCAAGGGTGGACCCATCTCTTTTGCAGATCTTATCCCGTATG
CAG
GTTATACACATTAATAATCCCAAATTTATGCCGTGCTGCATACTCTGGCCTTATTGCATGACCTAGTTTATGTACAGATGAACAGAATTTAATTCATCAACAGAGAAGACCAATGTC
CCTGACTCAATTTTGTTTGTTCTCTGCAGGACAAAGTGCTGTTAAGGCTACATTTCTGGCTTCTGCCATCCGCAAGTGTGGCGGTAATGAACAGAAAGGAAGCTTATTGTACTCCGCATA
TGGATCCAGTGGACAG
GTTAGTGTTTCTAATTTGGCTGTGTTGTGGACAGTTTTAATTTGCACCAGGATATATAAAATATTGGCAACTCTACCTCTGAACCAGCCTTATTATTAAAGTCA
AGGTCTAAAACAGTGGCTACATAAGAGTTATAGTATGCAGAAAGGTTAGGGAGATCCTTGTGTAAAAAGGAACATTACGATGACTGCAATTATGCTCAAATGAGTTCTCGTAAATACATA
CAGATAGAAGTAGATATTTCATCATTTTTCCTATCATCCGACCTACAAAAGGGTGTGTGTCTATTATCAATAAAAGCAAGTTATAGTGATAAGCAATTAATCCCAACAATTGTTGTTGTT
CTTATAGTGGGGATTGTTTGATAGACAATTCGGAAGGACAGATTCCCAAGAGCCAGATCCAGAAGGGAGGGTTCCCCAGTGGGAGAAAGCCACAGTCCAAGAAATGAAAGACAAGTTCTC
ATCTATTGGCTTTGGTCCCCGCCAG
GTATGCTTTCAACAAATATATTAAGGATCACGAGCTCACAACCTTCTAAAAAGACAGGAAATTTCACTTTGGAAAGACACCTATAGATGGTCGCT
GATCCAATTCTGTTCCTTCCCTGGTTGACCAGCTAGCTGTTATGTCTGCGTTCTTGGGTCCTGATCAAGCAGCAACAGAGGCCTTACTGGCAACTGATCCAGATGTTACACCATGGGTTC
AGAAGTACCAACGTAGCCGAGAAACAGTGTCTCAGACAGATTATGAG
GTCAGTTGATAATTCTCAACAGGGATCCCAATCAATTGAACCTGCCTAATTTGAAATTATGCGATGTAGTTCT
TGCTATGGAGGAGCAGAGGGAATTTGATGCTATTATGTACCGTTAAATCCTCGCATTTCCAAATTTATGTTGCCTCTAGATCTGTTCTAATTACGGTCTTGGAATTGATTTTCTTGCAGG
TCGATCTGATAACTACTCTCACCAAATTAAGTTCCATGGGCCAACAAATCAATTATGAAGCATATACATATCCTGTCCGAAAGATTGAGTTGAGCAAACTCAAGTTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGCTTCTTTCCTATCAACCCTCCCCTCTTTGGTTAGTGTCCCTTCTTTAACCATCTCTACTACTCCTACCATTAGATGTCCTTCTCATGCTGTCGCAATTCGTTGTCATAAAATG
GACACTGATGTCCCTGGTGAGAATGTTCTACGTCGAAGAGAAGTTTTGAAATGCTTTGGTGCTACTGTTGGCATG
GAATTGCTAGCAAGCTCAGGATCATTTGTTGAAATGGCTAGTGCT
GCTGATTTGATCCAACGCAGGCAGCGTTCTGAGTTTCAGT
CCAGCATAAGGCAGACCCTTTTCGCAGCTATAAAGGGCAAACCTGAACTTGTACCATACATTCTAACTCTGGCTCTGAAT
GATGCCATTACTTATGATAAG
GCTACAAAATCTGGGGGCCCAAATGGATCCATACGATTCAGTTCAGAGATAAGCAGACCTGAAAATAAGGGACTTTCTGCCGCGTTGAATTTAATAGAG
GAAGCGAAGGAGGAGATTGATTCATATTCCAAGGGTGGACCCATCTCTTTTGCAGATCTTATCCCGTATGCAG
GACAAAGTGCTGTTAAGGCTACATTTCTGGCTTCTGCCATCCGCAAG
TGTGGCGGTAATGAACAGAAAGGAAGCTTATTGTACTCCGCATATGGATCCAGTGGACAG
TGGGGATTGTTTGATAGACAATTCGGAAGGACAGATTCCCAAGAGCCAGATCCAGAAGGG
AGGGTTCCCCAGTGGGAGAAAGCCACAGTCCAAGAAATGAAAGACAAGTTCTCATCTATTGGCTTTGGTCCCCGCCAG
CTAGCTGTTATGTCTGCGTTCTTGGGTCCTGATCAAGCAGCA
ACAGAGGCCTTACTGGCAACTGATCCAGATGTTACACCATGGGTTCAGAAGTACCAACGTAGCCGAGAAACAGTGTCTCAGACAGATTATGAG
GTCGATCTGATAACTACTCTCACCAAA
TTAAGTTCCATGGGCCAACAAATCAATTATGAAGCATATACATATCCTGTCCGAAAGATTGAGTTGAGCAAACTCAAGTTATAG

Retrieve as FASTA