Entry information : PstrMnP01 (MnP1)
Entry ID 8517
Creation 2011-09-22 (Christophe Dunand)
Last sequence changes 2012-04-03 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-29 (Nizar Fawal)
Peroxidase information: PstrMnP01 (MnP1)
Name (synonym) PstrMnP01 (MnP1)
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Punctularia
Organism Punctularia strigosozonata    [TaxId: 202698 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PstrMnP01
start..stop
S start..stop
PstrMnP02 729 0 1..393 1..393
PstrMnP05 696 0 15..393 15..393
PstrMnP08 604 0 1..380 1..381
PstrMnP06 589 0 1..380 1..378
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1011392..1011572 181 N° 2 1011623..1011689 67 N° 3 1011744..1012140 397 N° 4 1012197..1012611 415
N° 5 1012665..1012786 122  
join(1011392..1011572,1011623..1011689,1011744..1012140,1012197..1012611,1012665 ..1012786)


exon

Literature and cross-references PstrMnP01 (MnP1)
DNA ref. JGI genome:   scaffold_6 (1011392..1012786)
Protein sequence: PstrMnP01 (MnP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   393 (375)
PWM (Da):   %s   40777.1 (39021.1)  
PI (pH):   %s   4.02 (3.99) Peptide Signal:   %s   cut: 19 range:19-393
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFASLLSLVALAAVARAAPTSEAAVCSDGTRVTNAACCAFIPLAQDLQENVLDGECGETAHEILRLTFHDAIGISQSLGPSAGTGADGSVLLFPTVEPEFFENDGISDSVNNLLPFLQRHDVTAGDLVQFAGAVALTNCPGAPRVQFLAGRPNATHPSINGLVPEPQDSVDTILDRFADAGNFSPFEVISLLASHSIARADKVDLAIDAAPFDTPFVMDTQIFLEVLLKGVGLPGPGNSSAEVLSPLPVGSGNDTGELRLQSDFALARDSRTACFWQGFVNQQDFMATSFKNAFEKLAVLGQNTKKLIDCSDAVPPASTVAVKPASFPATKGPADLEIACDARTFPTLTSDRGATETLIPHCPDGSQICADVDTDGPATDNDDPSTDPGTI

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTGCGTCGCTCCTCTCTCTCGTCGCTCTCGCAGCAGTCGCTCGTGCTGCTCCAACGTCTGAAGCTGCCGTTTGCTCCGACGGGACTCGTGTCACCAACGCCGCCTGCTGCGCC
TTCATCCCCCTCGCACAGGACCTGCAAGAGAACGTTCTCGATGGCGAGTGTGGTGAAACCG
GTAAGGTCCCGTTCTTCATGGATGGCAAACCTGGGCTCACAATAATGTAGCCCACGAGA
TTCTCCGCCTTACGTTCCACGACGCCATCGGTATCAGCCAGAGTCTTGGTCCTTCAGC
GTAAGTCGTGGAACCAGACTGCGTTCCAATACAATACCTGACTTCAGGTTACAGTGGCACAG
GCGCTGACGGCTCGGTCCTGCTGTTCCCGACGGTCGAGCCGGAGTTCTTCGAGAACGACGGTATCTCTGACAGCGTCAACAACCTGCTGCCATTCCTGCAGAGACACGACGTCACAGCCG
GTGACCTCGTCCAGTTTGCTGGCGCGGTCGCCCTGACCAACTGCCCTGGCGCGCCGCGCGTCCAATTCCTGGCCGGCCGTCCGAACGCGACCCACCCGTCCATTAACGGTCTCGTCCCTG
AGCCGCAGGACAGCGTCGACACCATCCTCGACCGTTTCGCAGACGCTGGCAATTTCTCTCCCTTCGAGGTTATCTCCCTCCTGGCTTCTCACAGTATCGCGCGTGCGGACAAGGTCGATC
TTGCCATCGACGCCGCTCCCTTCGACTCG
GTAAGTTGAGCCAAATTGTAACGCGCACTCATTTGCTCAATTCTTTTGCCCCGTAGACCCCGTTCGTAATGGACACCCAGATCTTCCTCGA
GGTTTTGCTCAAGGGTGTTGGGCTCCCCGGACCCGGCAACAGCTCCGCTGAGGTCCTATCTCCCCTCCCCGTCGGCAGCGGCAACGACACGGGCGAGCTCCGCCTCCAGTCCGACTTCGC
GCTCGCCCGCGACTCGCGCACGGCCTGCTTCTGGCAAGGATTTGTTAACCAGCAGGATTTCATGGCCACCAGCTTCAAGAACGCATTTGAGAAGCTCGCTGTCCTCGGCCAGAACACCAA
GAAGCTGATCGACTGCTCAGACGCCGTTCCTCCGGCTAGCACCGTCGCCGTCAAGCCCGCCTCCTTCCCCGCGACCAAGGGTCCGGCCGACCTCGAGATTGCCTGTGATGCGCGCACGTT
CCCTACTCTCACCTCTGACC
GTAAGTATCGTGCATCTGTATTCGCACGGCCGGGCGCTGATTGCCTCTCTCAGGCGGCGCGACCGAGACGTTGATCCCGCACTGCCCGGACGGCTCTCAG
ATTTGCGCAGACGTCGACACCGACGGCCCGGCCACCGATAACGACGACCCGAGCACCGACCCCGGCACCATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTGCGTCGCTCCTCTCTCTCGTCGCTCTCGCAGCAGTCGCTCGTGCTGCTCCAACGTCTGAAGCTGCCGTTTGCTCCGACGGGACTCGTGTCACCAACGCCGCCTGCTGCGCC
TTCATCCCCCTCGCACAGGACCTGCAAGAGAACGTTCTCGATGGCGAGTGTGGTGAAACCG
CCCACGAGATTCTCCGCCTTACGTTCCACGACGCCATCGGTATCAGCCAGAGTCTTGGT
CCTTCAGC
TGGCACAGGCGCTGACGGCTCGGTCCTGCTGTTCCCGACGGTCGAGCCGGAGTTCTTCGAGAACGACGGTATCTCTGACAGCGTCAACAACCTGCTGCCATTCCTGCAGAGA
CACGACGTCACAGCCGGTGACCTCGTCCAGTTTGCTGGCGCGGTCGCCCTGACCAACTGCCCTGGCGCGCCGCGCGTCCAATTCCTGGCCGGCCGTCCGAACGCGACCCACCCGTCCATT
AACGGTCTCGTCCCTGAGCCGCAGGACAGCGTCGACACCATCCTCGACCGTTTCGCAGACGCTGGCAATTTCTCTCCCTTCGAGGTTATCTCCCTCCTGGCTTCTCACAGTATCGCGCGT
GCGGACAAGGTCGATCTTGCCATCGACGCCGCTCCCTTCGACTCG
ACCCCGTTCGTAATGGACACCCAGATCTTCCTCGAGGTTTTGCTCAAGGGTGTTGGGCTCCCCGGACCCGGCAAC
AGCTCCGCTGAGGTCCTATCTCCCCTCCCCGTCGGCAGCGGCAACGACACGGGCGAGCTCCGCCTCCAGTCCGACTTCGCGCTCGCCCGCGACTCGCGCACGGCCTGCTTCTGGCAAGGA
TTTGTTAACCAGCAGGATTTCATGGCCACCAGCTTCAAGAACGCATTTGAGAAGCTCGCTGTCCTCGGCCAGAACACCAAGAAGCTGATCGACTGCTCAGACGCCGTTCCTCCGGCTAGC
ACCGTCGCCGTCAAGCCCGCCTCCTTCCCCGCGACCAAGGGTCCGGCCGACCTCGAGATTGCCTGTGATGCGCGCACGTTCCCTACTCTCACCTCTGACC
GCGGCGCGACCGAGACGTTG
ATCCCGCACTGCCCGGACGGCTCTCAGATTTGCGCAGACGTCGACACCGACGGCCCGGCCACCGATAACGACGACCCGAGCACCGACCCCGGCACCATCTAA

Retrieve as FASTA