Entry information : PstrMnP02 (MnP2)
Entry ID 8518
Creation 2011-09-22 (Christophe Dunand)
Last sequence changes 2011-09-22 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-29 (Nizar Fawal)
Peroxidase information: PstrMnP02 (MnP2)
Name (synonym) PstrMnP02 (MnP2)
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Punctularia
Organism Punctularia strigosozonata    [TaxId: 202698 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PstrMnP02
start..stop
S start..stop
PstrMnP01 710 0 1..393 1..393
PstrMnP05 676 0 15..393 15..393
PstrMnP08 598 0 1..380 1..381
PstrMnP09 590 0 1..380 1..379
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 944177..944357 181 N° 2 944058..944124 67 N° 3 943612..944008 397 N° 4 943139..943553 415
N° 5 942951..943075 125  
complement(join(942951..943075,943139..943553,943612..944008,944058..944124,9441 77..944357))


exon

Literature and cross-references PstrMnP02 (MnP2)
DNA ref. JGI genome:   scaffold_7 (944357..942951)
Protein sequence: PstrMnP02 (MnP2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   394 (376)
PWM (Da):   %s   40738.98 (38938.9)  
PI (pH):   %s   3.89 (3.86) Peptide Signal:   %s   cut: 19 range:19-394
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFASLLSLVALAAITRAAPTSNSAVCSDGTTVSNAACCAFIPLAQDLQENVLENECGETAHEIIRLMFHDAIGISQSLGPSAGTGADGSVLLFPTVEPEFFENDGISDSVNNLLPFLQRHDVTAGDLVQFAGAVALTNCPGAPRIQFLAGRPNATHPSINGLVPEPQDSVDTILGRFADAGNFSAFEVISLLASHSIARADKVDLAIDAAPFDTPFVMDTQIFLEVLLKGVGLPGPGNSSAEVPSPLPVGSGNDTGELRLQSDFALARDNRTACFWQGFVNQQDFMASSFSAAVAKLAVLGQNVEELIDCSDVVPPASTVAVAPASFPATKGPADLEIACDARTFPTLTQDRGATETLIPHCPDGSQICPDNDTPGPATDNDDPSTDPGTIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTGCGTCGCTCCTCTCTCTTGTTGCGCTCGCCGCGATCACTCGAGCTGCCCCTACCAGTAACTCTGCGGTCTGCTCCGACGGCACCACTGTCAGCAACGCAGCCTGCTGCGCG
TTCATCCCGCTAGCCCAGGATCTGCAAGAGAATGTCCTCGAAAACGAGTGCGGTGAAACTG
GTAAGAAAACCTATTTTTCTGCATGATTGCTCGTTCTTTAACGGCACCTTAGCCCACGA
GATCATCCGTTTGATGTTCCACGATGCCATTGGTATCAGCCAGAGCCTCGGTCCTTCAGC
GTAAGCCTCGTAACTAAACTGCAATATGGTATCTAATCCCAGGCTATAGTGGCACCGGTG
CTGACGGCTCAGTCCTACTGTTCCCGACGGTTGAGCCCGAGTTCTTCGAGAACGACGGTATCTCCGACAGCGTCAACAACCTGCTGCCGTTCCTGCAGAGGCACGACGTCACCGCCGGCG
ACCTCGTCCAGTTCGCTGGCGCTGTAGCGCTGACCAACTGCCCCGGCGCACCGCGCATCCAGTTCCTCGCCGGTCGCCCGAACGCGACTCATCCGTCTATCAACGGCCTCGTGCCCGAGC
CGCAGGACAGCGTCGACACCATCCTCGGCCGCTTCGCGGACGCGGGCAACTTCTCGGCGTTCGAGGTGATCTCCCTCCTGGCCTCGCACAGCATCGCCCGCGCAGACAAGGTCGACCTCG
CCATCGACGCCGCTCCCTTCGACTCC
GTGAGTCTAATGCTTCGCCGGCTCCCTGCCAGATGCTGAAACGACATTCCAAACACAGACTCCGTTCGTGATGGACACTCAAATCTTCCTCGAG
GTCCTGCTCAAGGGTGTCGGCCTTCCCGGACCCGGCAACAGCTCCGCTGAGGTGCCCTCACCCCTCCCCGTCGGCAGCGGGAACGACACGGGCGAACTCCGCCTCCAGTCAGACTTCGCC
CTCGCCCGCGACAATCGCACTGCCTGCTTCTGGCAAGGGTTCGTCAACCAACAGGATTTCATGGCCAGCAGCTTCAGTGCCGCAGTCGCCAAGCTCGCGGTGCTCGGCCAGAACGTGGAA
GAGCTCATCGACTGCTCCGACGTCGTCCCGCCCGCTAGCACCGTCGCTGTCGCGCCCGCTTCTTTCCCGGCCACCAAGGGTCCGGCCGACCTGGAGATCGCCTGTGACGCCCGGACGTTC
CCCACCCTCACACAGGACC
GTAAGTAACGCTCGATCGGTCTAGCTTTCCACGCTACCAGAAAGCTAACGACCTTGCGCACAGGTGGCGCCACCGAGACGTTGATCCCTCACTGCCCCGAC
GGCAGCCAGATTTGCCCCGACAACGACACGCCAGGGCCCGCCACCGACAACGATGACCCCAGCACCGACCCTGGCACCATCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTGCGTCGCTCCTCTCTCTTGTTGCGCTCGCCGCGATCACTCGAGCTGCCCCTACCAGTAACTCTGCGGTCTGCTCCGACGGCACCACTGTCAGCAACGCAGCCTGCTGCGCG
TTCATCCCGCTAGCCCAGGATCTGCAAGAGAATGTCCTCGAAAACGAGTGCGGTGAAACTG
CCCACGAGATCATCCGTTTGATGTTCCACGATGCCATTGGTATCAGCCAGAGCCTCGGT
CCTTCAGC
TGGCACCGGTGCTGACGGCTCAGTCCTACTGTTCCCGACGGTTGAGCCCGAGTTCTTCGAGAACGACGGTATCTCCGACAGCGTCAACAACCTGCTGCCGTTCCTGCAGAGG
CACGACGTCACCGCCGGCGACCTCGTCCAGTTCGCTGGCGCTGTAGCGCTGACCAACTGCCCCGGCGCACCGCGCATCCAGTTCCTCGCCGGTCGCCCGAACGCGACTCATCCGTCTATC
AACGGCCTCGTGCCCGAGCCGCAGGACAGCGTCGACACCATCCTCGGCCGCTTCGCGGACGCGGGCAACTTCTCGGCGTTCGAGGTGATCTCCCTCCTGGCCTCGCACAGCATCGCCCGC
GCAGACAAGGTCGACCTCGCCATCGACGCCGCTCCCTTCGACTCC
ACTCCGTTCGTGATGGACACTCAAATCTTCCTCGAGGTCCTGCTCAAGGGTGTCGGCCTTCCCGGACCCGGCAAC
AGCTCCGCTGAGGTGCCCTCACCCCTCCCCGTCGGCAGCGGGAACGACACGGGCGAACTCCGCCTCCAGTCAGACTTCGCCCTCGCCCGCGACAATCGCACTGCCTGCTTCTGGCAAGGG
TTCGTCAACCAACAGGATTTCATGGCCAGCAGCTTCAGTGCCGCAGTCGCCAAGCTCGCGGTGCTCGGCCAGAACGTGGAAGAGCTCATCGACTGCTCCGACGTCGTCCCGCCCGCTAGC
ACCGTCGCTGTCGCGCCCGCTTCTTTCCCGGCCACCAAGGGTCCGGCCGACCTGGAGATCGCCTGTGACGCCCGGACGTTCCCCACCCTCACACAGGACC
GTGGCGCCACCGAGACGTTG
ATCCCTCACTGCCCCGACGGCAGCCAGATTTGCCCCGACAACGACACGCCAGGGCCCGCCACCGACAACGATGACCCCAGCACCGACCCTGGCACCATCAACTAG

Retrieve as FASTA