Entry information : PstrMnP05 (MnP5)
Entry ID 8519
Creation 2011-09-22 (Christophe Dunand)
Last sequence changes 2012-04-03 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-29 (Nizar Fawal)
Peroxidase information: PstrMnP05 (MnP5)
Name (synonym) PstrMnP05 (MnP5)
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Punctularia
Organism Punctularia strigosozonata    [TaxId: 202698 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PstrMnP05
start..stop
S start..stop
PstrMnP01 698 0 1..393 1..393
PstrMnP02 697 0 1..393 1..393
PstrMnP08 611 0 1..380 1..381
PstrMnP06 595 0 1..380 1..378
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1070500..1070680 181 N° 2 1070385..1070451 67 N° 3 1069931..1070327 397 N° 4 1069461..1069875 415
N° 5 1069286..1069407 122  
complement(join(1069286..1069407,1069461..1069875,1069931..1070327,1070385..1070 451,1070500..1070680))


exon

Literature and cross-references PstrMnP05 (MnP5)
DNA ref. JGI genome:   scaffold_6 (1070680..1069286)
Protein sequence: PstrMnP05 (MnP5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   393 (375)
PWM (Da):   %s   40901.24 (39129.2)  
PI (pH):   %s   4.19 (4.15) Peptide Signal:   %s   cut: 19 range:19-393
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFASLLALTALAAVTRAAPTAEAAICSDGTRVSNSACCAFIPLAKDLQENVLENECGETAHEILRLTFHDAIGISQKLGPKAGTGADGSVLLFPTVEPEFFANDGISDSVNNLLPFLQRHKVSAGDLVQFAGAVALTNCPGAPRIQFLAGRPNATHPSIEGLVPEPQDSVDTILDRFADAGNFSPFEVISLLASHSIARADKVDLTIDAAPFDTPFVMDTQIFLEVLLEGTGFPGAGPSDAQAASPLPVGSGNDTGELRLQSDFALARDPRTACFWQGFVNQQEFMATSFKNAMAKLATLGQNTRNLIDCSEVVPPASTVAVKPASFPATKGPADLQIACNARTFPTLTSDRGATETLIPHCPDGSQICPSVDTDGPATDNDDPSTDPGTL

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCGCGTCTCTTCTCGCCCTCACCGCCCTCGCCGCTGTCACTCGCGCCGCCCCGACCGCGGAGGCCGCGATCTGCTCCGATGGCACCCGCGTCTCCAACTCTGCCTGCTGCGCG
TTCATCCCGCTCGCAAAGGACCTGCAGGAGAACGTCCTCGAGAACGAGTGCGGTGAAACTG
GTAAATTCCTGCCTTCGACTACATGATCGTTCGCTAACGGTGCTATAGCGCATGAGATC
CTCCGTCTGACGTTCCACGACGCCATTGGAATCAGCCAGAAGCTCGGCCCGAAGGC
GTAAGTAACCTTCATAGCGATGTGTCTCCGGAGCCAGCGTCTGACCCCGACTCACAGCGGCACC
GGTGCTGACGGCTCTGTCCTGCTCTTCCCCACAGTCGAGCCCGAGTTCTTCGCCAACGACGGTATCTCCGACAGTGTCAACAACCTGCTGCCGTTCCTGCAGAGGCACAAAGTCTCCGCC
GGCGACCTCGTCCAGTTCGCTGGTGCCGTCGCACTGACCAACTGCCCTGGTGCACCCCGCATCCAGTTCCTCGCCGGCCGCCCGAACGCGACCCACCCGTCCATCGAAGGTCTCGTCCCC
GAGCCGCAGGACAGCGTCGACACCATCCTCGACCGTTTCGCAGACGCTGGCAATTTCTCTCCCTTCGAGGTTATCTCCCTCCTGGCTTCTCACAGTATCGCGCGTGCGGACAAGGTCGAC
CTCACTATCGACGCCGCTCCCTTTGACTCG
GTGAGTTAAACGAAACTGAAACGCGCGCCCATTTGCTCATTTTTGTGCCCCGTAGACCCCGTTCGTGATGGACACCCAGATCTTCCTCGA
GGTCTTGCTCGAGGGCACCGGATTCCCCGGAGCTGGTCCCAGCGACGCCCAGGCCGCCTCCCCCCTCCCCGTTGGCAGCGGCAACGACACCGGCGAGCTCCGCCTCCAGTCCGACTTCGC
GCTCGCCCGCGACCCGCGCACAGCCTGCTTCTGGCAGGGCTTCGTCAACCAGCAGGAGTTCATGGCCACCAGCTTCAAGAACGCGATGGCCAAGCTCGCCACTCTTGGCCAGAACACCAG
GAACCTGATCGACTGCTCTGAGGTCGTCCCACCGGCCAGCACCGTCGCCGTCAAGCCCGCGTCCTTCCCCGCGACCAAAGGCCCCGCCGACCTCCAGATCGCCTGCAACGCGCGCACCTT
CCCTACTCTCACCTCTGACC
GTAAGTATCTTAGGTCTGTATTCGCACGGACGAGCGCTGATTGCCTCTCTCAGGCGGCGCAACCGAGACGTTGATCCCGCACTGCCCGGACGGCTCTCAG
ATTTGCCCATCCGTCGACACCGACGGCCCGGCCACCGACAACGACGACCCGAGCACCGACCCCGGCACCCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCGCGTCTCTTCTCGCCCTCACCGCCCTCGCCGCTGTCACTCGCGCCGCCCCGACCGCGGAGGCCGCGATCTGCTCCGATGGCACCCGCGTCTCCAACTCTGCCTGCTGCGCG
TTCATCCCGCTCGCAAAGGACCTGCAGGAGAACGTCCTCGAGAACGAGTGCGGTGAAACTG
CGCATGAGATCCTCCGTCTGACGTTCCACGACGCCATTGGAATCAGCCAGAAGCTCGGC
CCGAAGGC
CGGCACCGGTGCTGACGGCTCTGTCCTGCTCTTCCCCACAGTCGAGCCCGAGTTCTTCGCCAACGACGGTATCTCCGACAGTGTCAACAACCTGCTGCCGTTCCTGCAGAGG
CACAAAGTCTCCGCCGGCGACCTCGTCCAGTTCGCTGGTGCCGTCGCACTGACCAACTGCCCTGGTGCACCCCGCATCCAGTTCCTCGCCGGCCGCCCGAACGCGACCCACCCGTCCATC
GAAGGTCTCGTCCCCGAGCCGCAGGACAGCGTCGACACCATCCTCGACCGTTTCGCAGACGCTGGCAATTTCTCTCCCTTCGAGGTTATCTCCCTCCTGGCTTCTCACAGTATCGCGCGT
GCGGACAAGGTCGACCTCACTATCGACGCCGCTCCCTTTGACTCG
ACCCCGTTCGTGATGGACACCCAGATCTTCCTCGAGGTCTTGCTCGAGGGCACCGGATTCCCCGGAGCTGGTCCC
AGCGACGCCCAGGCCGCCTCCCCCCTCCCCGTTGGCAGCGGCAACGACACCGGCGAGCTCCGCCTCCAGTCCGACTTCGCGCTCGCCCGCGACCCGCGCACAGCCTGCTTCTGGCAGGGC
TTCGTCAACCAGCAGGAGTTCATGGCCACCAGCTTCAAGAACGCGATGGCCAAGCTCGCCACTCTTGGCCAGAACACCAGGAACCTGATCGACTGCTCTGAGGTCGTCCCACCGGCCAGC
ACCGTCGCCGTCAAGCCCGCGTCCTTCCCCGCGACCAAAGGCCCCGCCGACCTCCAGATCGCCTGCAACGCGCGCACCTTCCCTACTCTCACCTCTGACC
GCGGCGCAACCGAGACGTTG
ATCCCGCACTGCCCGGACGGCTCTCAGATTTGCCCATCCGTCGACACCGACGGCCCGGCCACCGACAACGACGACCCGAGCACCGACCCCGGCACCCTCTAA

Retrieve as FASTA