Entry information : PstrMnP09 (MnP9)
Entry ID 8521
Creation 2011-09-22 (Christophe Dunand)
Last sequence changes 2011-09-23 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-29 (Nizar Fawal)
Peroxidase information: PstrMnP09 (MnP9)
Name (synonym) PstrMnP09 (MnP9)
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Punctularia
Organism Punctularia strigosozonata    [TaxId: 202698 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PstrMnP09
start..stop
S start..stop
PstrMnP06 645 0 1..379 1..378
PstrMnP08 638 0 1..379 1..381
PstrMnP07 632 0 1..379 1..378
PgigMnP05 620 0 1..379 1..381
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 290485..290665 181 N° 2 290720..290786 67 N° 3 290841..291237 397 N° 4 291296..291707 412
N° 5 291758..291840 83  
join(290485..290665,290720..290786,290841..291237,291296..291707,291758..291840)


exon

Literature and cross-references PstrMnP09 (MnP9)
DNA ref. JGI genome:   scaffold_6 (290485..291840)
Protein sequence: PstrMnP09 (MnP9)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   379 (361)
PWM (Da):   %s   39427.17 (37676.2)  
PI (pH):   %s   4.02 (4.02) Peptide Signal:   %s   cut: 19 range:19-379
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFTSLLAFVALAAVSSAVPTSKRATCPDGSTVSNAACCAFIPLAQDLQETIFQNECGEDAHEVIRLAFHDAIAISQSQGAKAGGGADGSMLLFPTVEPNFSANNGIDDSVNNLIPFLSRHNVTAGDLVQFAGAVALSNCPGAPQLQFMAGRPNATAPAIDGLIPEPQDSVDKILDRFADAGNFSPFEVVSLLASHSVARADKVDLTIDAAPFDTPFTFDTQVFLEVLLTGTGFPGTGNNTGEVESPLPVSSGNDTGELRLQSDFAFARDNRTACFWQGFVNQQDFMVSSFKAAMAKLAVLGHNTEDLIDCSDVVPAPSTATVAPASFPATKGPADLELVCNATFPTLTEDRGATETLIPHCPDGSQDCPSVQFTGPA

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCACCTCTCTCCTCGCCTTTGTCGCACTCGCTGCTGTTTCGAGCGCAGTGCCGACCTCCAAGCGCGCTACGTGCCCTGACGGCTCCACCGTCAGCAACGCCGCATGCTGCGCG
TTCATCCCACTCGCTCAGGATCTGCAAGAGACCATCTTCCAGAATGAGTGCGGCGAGGATG
GTAAGACCAATCGCTTCACCATTTGATGTCCTGTGCTGATAGATGTGTACTCAGCTCAC
GAGGTCATTCGCCTGGCCTTCCACGACGCCATTGCTATCAGCCAAAGCCAAGGCGCCAAGGC
GTTAGTGAAATTATCATGTCAGATAACATGCACATTATCTGACACACCTCACAGAGGT
GGCGGAGCCGACGGTTCGATGCTTTTGTTCCCGACCGTCGAGCCCAACTTCTCGGCCAACAACGGCATTGACGACAGCGTGAACAACTTGATCCCCTTCCTCTCCAGGCACAACGTCACC
GCCGGCGACCTCGTCCAGTTCGCCGGTGCCGTTGCACTCAGCAACTGTCCTGGTGCACCTCAGCTTCAATTCATGGCGGGCCGTCCCAACGCCACTGCTCCCGCCATTGATGGCCTCATA
CCCGAGCCGCAGGACAGCGTCGACAAGATCCTCGACCGTTTCGCGGACGCCGGCAACTTCTCGCCTTTCGAGGTCGTCTCGCTCCTCGCCTCGCACAGTGTTGCCCGTGCGGACAAGGTC
GACCTGACCATCGACGCTGCGCCCTTCGACACC
GTGAGTCCTCCTCTACCCGTACATGCATGAACCTTTGATCCACAATTTATCTCCCCAGACGCCCTTCACCTTCGACACCCAGGTGTT
CCTCGAGGTGCTGCTCACCGGAACTGGCTTCCCAGGAACCGGTAACAACACCGGTGAGGTCGAGTCACCCCTGCCAGTTTCTAGCGGGAACGATACCGGCGAGCTGCGTCTCCAGTCCGA
CTTTGCCTTCGCCCGCGACAACCGTACGGCTTGCTTCTGGCAAGGGTTCGTCAACCAGCAGGATTTCATGGTGAGCAGCTTCAAGGCTGCCATGGCCAAGCTCGCCGTCCTCGGCCACAA
CACCGAGGACCTAATCGACTGCTCCGACGTCGTACCCGCGCCCAGCACGGCCACGGTTGCCCCCGCCTCGTTCCCGGCTACTAAGGGCCCTGCGGACCTCGAGCTCGTCTGCAACGCCAC
GTTCCCGACGCTCACCGAGGACC
GTGAGTATATCGATCCATTCGCGATCCATTGATATTAACAAAATTTCCAGGCGGTGCAACCGAAACTCTCATCCCTCACTGCCCCGACGGCAGCCAG
GACTGCCCTTCCGTGCAGTTCACGGGCCCCGCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCACCTCTCTCCTCGCCTTTGTCGCACTCGCTGCTGTTTCGAGCGCAGTGCCGACCTCCAAGCGCGCTACGTGCCCTGACGGCTCCACCGTCAGCAACGCCGCATGCTGCGCG
TTCATCCCACTCGCTCAGGATCTGCAAGAGACCATCTTCCAGAATGAGTGCGGCGAGGATG
CTCACGAGGTCATTCGCCTGGCCTTCCACGACGCCATTGCTATCAGCCAAAGCCAAGGC
GCCAAGGC
AGGTGGCGGAGCCGACGGTTCGATGCTTTTGTTCCCGACCGTCGAGCCCAACTTCTCGGCCAACAACGGCATTGACGACAGCGTGAACAACTTGATCCCCTTCCTCTCCAGG
CACAACGTCACCGCCGGCGACCTCGTCCAGTTCGCCGGTGCCGTTGCACTCAGCAACTGTCCTGGTGCACCTCAGCTTCAATTCATGGCGGGCCGTCCCAACGCCACTGCTCCCGCCATT
GATGGCCTCATACCCGAGCCGCAGGACAGCGTCGACAAGATCCTCGACCGTTTCGCGGACGCCGGCAACTTCTCGCCTTTCGAGGTCGTCTCGCTCCTCGCCTCGCACAGTGTTGCCCGT
GCGGACAAGGTCGACCTGACCATCGACGCTGCGCCCTTCGACACC
ACGCCCTTCACCTTCGACACCCAGGTGTTCCTCGAGGTGCTGCTCACCGGAACTGGCTTCCCAGGAACCGGTAAC
AACACCGGTGAGGTCGAGTCACCCCTGCCAGTTTCTAGCGGGAACGATACCGGCGAGCTGCGTCTCCAGTCCGACTTTGCCTTCGCCCGCGACAACCGTACGGCTTGCTTCTGGCAAGGG
TTCGTCAACCAGCAGGATTTCATGGTGAGCAGCTTCAAGGCTGCCATGGCCAAGCTCGCCGTCCTCGGCCACAACACCGAGGACCTAATCGACTGCTCCGACGTCGTACCCGCGCCCAGC
ACGGCCACGGTTGCCCCCGCCTCGTTCCCGGCTACTAAGGGCCCTGCGGACCTCGAGCTCGTCTGCAACGCCACGTTCCCGACGCTCACCGAGGACC
GCGGTGCAACCGAAACTCTCATC
CCTCACTGCCCCGACGGCAGCCAGGACTGCCCTTCCGTGCAGTTCACGGGCCCCGCGTAA

Retrieve as FASTA