Entry information : PstrMnP11 (GP)
Entry ID 8525
Creation 2011-09-22 (Christophe Dunand)
Last sequence changes 2011-09-22 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-30 (Nizar Fawal)
Peroxidase information: PstrMnP11 (GP)
Name (synonym) PstrMnP11 (GP)
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Punctularia
Organism Punctularia strigosozonata    [TaxId: 202698 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PstrMnP11
start..stop
S start..stop
PstrMnP08 553 0 1..381 1..381
PstrMnP06 523 0 1..381 1..378
PstrMnP02 521 0 1..381 1..380
PstrMnP07 518 0 1..381 1..378
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2693396..2693576 181 N° 2 2693628..2693694 67 N° 3 2693745..2694144 400 N° 4 2694198..2694701 504
join(2693396..2693576,2693628..2693694,2693745..2694144,2694198..2694701)


exon

Literature and cross-references PstrMnP11 (GP)
DNA ref. JGI genome:   scaffold_2 (2693396..2694701)
Protein sequence: PstrMnP11 (GP)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   383 (365)
PWM (Da):   %s   40218.04 (38377.1)  
PI (pH):   %s   4.41 (4.41) Peptide Signal:   %s   cut: 19 range:19-383
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFASLIASVALFTLSFAAPTSDAAVCSDGTRVNNTACCAFIPLAADLQENLFQDECSKDAQEVIRLAFVDAIGISQSQGPLAGGGADGSVLLFPTVEPHYAENNGTQDSVNNLLHFLSLHPDVSAGDLVQFAAAVALINCPGAPQLQFLAGRPKRVSVPAVRGLVPQPQDNVTKILARFADAGGFSPFEVVSLLATHSIAHSNLDPTARDAPLDTPFVMDTQFFLETLLKGTGFPGTGNRTGEAESPYTITIGNDTGELRLQSDLALARDPRTACFWQGFVNQQAFMASSFKAAMAKLAVLGQNTRTLVDCSDVVPPASTRTVPPATFPNTKGPGDLELTCDTEVFPTLVQPRGATETFIPHCPDGSMSCTNIQFPGPARK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCGCGTCGCTGATCGCCTCCGTCGCCTTGTTCACTTTATCCTTTGCTGCACCAACGAGCGATGCCGCCGTCTGCTCCGACGGGACTCGCGTCAACAATACGGCCTGCTGCGCT
TTCATCCCACTTGCTGCGGATCTTCAAGAGAATCTTTTCCAGGACGAATGTAGCAAAGACG
GTACGATCCAATCACATGAAATCCAGAATCATCCTGTTTACATTCTCATAGCCCAAGAA
GTCATACGGTTGGCTTTTGTGGACGCCATCGGCATCAGTCAGAGCCAAGGACCCCTAGC
GTGAGCTAGTTGCGCTTCTACCTAGAATCCAAACTGACGTAGATTGCCAGTGGCGGTGGTG
CCGACGGTTCTGTGCTGCTCTTCCCCACAGTCGAGCCTCATTATGCAGAAAACAACGGCACCCAAGACAGCGTGAACAACCTCTTGCATTTCCTCTCCCTCCACCCGGACGTTTCTGCCG
GCGATCTTGTCCAATTCGCTGCCGCAGTCGCGCTCATCAACTGCCCTGGCGCGCCGCAGCTGCAGTTCCTCGCCGGCCGACCGAAGCGCGTTTCCGTGCCCGCCGTGCGCGGGCTTGTCC
CTCAACCGCAGGACAACGTGACCAAGATCCTCGCGCGCTTTGCCGACGCAGGGGGCTTCTCACCATTCGAGGTCGTCTCCCTCCTGGCGACGCACAGTATCGCACATTCGAACCTCGATC
CAACAGCCAGAGACGCACCCTTGGACACG
GTGCGTCTTATACGATCGCTCGGTTGCCGCAGACGACTGACGCCCCAACCCAGACGCCGTTCGTGATGGACACTCAGTTTTTCCTCGAGAC
CCTCCTCAAAGGAACCGGCTTCCCCGGCACGGGTAACCGCACGGGCGAGGCCGAATCTCCGTACACGATCACCATCGGCAACGACACCGGCGAACTGCGACTGCAGTCCGACTTGGCGCT
CGCGCGCGACCCGCGCACGGCGTGCTTCTGGCAAGGCTTTGTCAACCAGCAGGCGTTCATGGCGTCCAGCTTCAAAGCGGCAATGGCCAAGCTGGCAGTACTGGGACAGAACACGCGAAC
GCTCGTGGATTGTTCGGACGTCGTCCCTCCCGCGAGCACGCGCACCGTCCCGCCGGCGACGTTTCCGAACACGAAGGGCCCGGGTGACCTCGAGCTGACGTGCGACACGGAGGTGTTCCC
GACGCTCGTTCAACCGCGCGGGGCGACGGAGACGTTCATCCCGCACTGTCCGGACGGAAGTATGAGCTGCACCAACATCCAATTCCCTGGTCCGGCTCGGAAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCGCGTCGCTGATCGCCTCCGTCGCCTTGTTCACTTTATCCTTTGCTGCACCAACGAGCGATGCCGCCGTCTGCTCCGACGGGACTCGCGTCAACAATACGGCCTGCTGCGCT
TTCATCCCACTTGCTGCGGATCTTCAAGAGAATCTTTTCCAGGACGAATGTAGCAAAGACG
CCCAAGAAGTCATACGGTTGGCTTTTGTGGACGCCATCGGCATCAGTCAGAGCCAAGGA
CCCCTAGC
TGGCGGTGGTGCCGACGGTTCTGTGCTGCTCTTCCCCACAGTCGAGCCTCATTATGCAGAAAACAACGGCACCCAAGACAGCGTGAACAACCTCTTGCATTTCCTCTCCCTC
CACCCGGACGTTTCTGCCGGCGATCTTGTCCAATTCGCTGCCGCAGTCGCGCTCATCAACTGCCCTGGCGCGCCGCAGCTGCAGTTCCTCGCCGGCCGACCGAAGCGCGTTTCCGTGCCC
GCCGTGCGCGGGCTTGTCCCTCAACCGCAGGACAACGTGACCAAGATCCTCGCGCGCTTTGCCGACGCAGGGGGCTTCTCACCATTCGAGGTCGTCTCCCTCCTGGCGACGCACAGTATC
GCACATTCGAACCTCGATCCAACAGCCAGAGACGCACCCTTGGACACG
ACGCCGTTCGTGATGGACACTCAGTTTTTCCTCGAGACCCTCCTCAAAGGAACCGGCTTCCCCGGCACGGGT
AACCGCACGGGCGAGGCCGAATCTCCGTACACGATCACCATCGGCAACGACACCGGCGAACTGCGACTGCAGTCCGACTTGGCGCTCGCGCGCGACCCGCGCACGGCGTGCTTCTGGCAA
GGCTTTGTCAACCAGCAGGCGTTCATGGCGTCCAGCTTCAAAGCGGCAATGGCCAAGCTGGCAGTACTGGGACAGAACACGCGAACGCTCGTGGATTGTTCGGACGTCGTCCCTCCCGCG
AGCACGCGCACCGTCCCGCCGGCGACGTTTCCGAACACGAAGGGCCCGGGTGACCTCGAGCTGACGTGCGACACGGAGGTGTTCCCGACGCTCGTTCAACCGCGCGGGGCGACGGAGACG
TTCATCCCGCACTGTCCGGACGGAAGTATGAGCTGCACCAACATCCAATTCCCTGGTCCGGCTCGGAAATGA

Retrieve as FASTA