Entry information : TvVP01
Entry ID 8528
Creation 2011-09-23 (Christophe Dunand)
Last sequence changes 2011-09-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: TvVP01
Name TvVP01
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvVP01
start..stop
S start..stop
TvCIIBA03_Gangwondo 731 0 1..364 1..364
TvCIIBA03_CU1 696 0 1..364 1..362
GapCIIBA01 555 0 1..364 1..364
GauCIIBA01 553 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 411488..411604 117 N° 2 411662..411705 44 N° 3 411763..411808 46 N° 4 411862..411920 59
N° 5 411975..411988 14 N° 6 412041..412161 121 N° 7 412232..412463 232 N° 8 412592..412761 170
N° 9 412838..412875 38 N° 10 412936..413148 213 N° 11 413212..413236 25 N° 12 413295..413310 16
join(411488..411604,411662..411705,411763..411808,411862..411920,411975..411988, 412041..412161,412232..412463,412592..412761,412838..412875,412936..413148,41321 2..413236,413295..413310)


exon

Literature and cross-references TvVP01
DNA ref. JGI genome:   scaffold_2 (411488..413310)
Protein sequence: TvVP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364
PWM (Da):   %s   38036.53  
PI (pH):   %s   4.08
Sequence 405
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSKALLSIVALAASFTAAVPSANKRATCSGGQTTANDACCVWFDVLDDIQSNLFHGGECGENAHESLRLIFHDAIAFSPALTAAGQFGGGGADGSIMAHTDVEIQYAANNGLDEIIEEQRPFALKHNVSFGDFIQFAGAVGVSNCNGGPQIGFFAGRSNDSQPAPDNLVPLPSDSVTDILARVADAGFAPVELVWMLISHTVAAQDKVDDSIPGTPFDSTPSDFDAQFFVESMLNGTLTPGSALHDGEVQSPLPGEFRLQSDFLIGRDSRTSCEWQKMIADRANMLQKFEQTVLKLSLLGFSQSALTDCSDVIPIATGTVADPFLPAGKTMADIEAACAATPFPTLSAAPGPETTIPAVPLDS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTTCTCCAAGGCCCTCCTCTCCATCGTCGCTCTCGCTGCGTCCTTCACCGCTGCTGTCCCGTCCGCCAACAAGCGGGCTACCTGCAGCGGCGGTCAGACCACTGCTAACGATGCGGTGA
GTATCACGCTGCTACGTCGATCGTGCTTAGCACCGTGCTGACGATCTTCACAGTGCTGCGTGTGGTTCGACGTCCTCGACGACATTCAGAGCAACCTGTAAGTCGCATTCAGTACTCTGG
ACGTTGTGGCCGGTCCCTCATCCGATGTTCGCAGCTTCCACGGCGGCGAGTGTGGCGAGAACGCCCACGAATCTCTCCGGGTAACTACCCTTGGAAGCTTAGACATCTTTAGCCGCTGAT
CACCACCATCCAGCTCATCTTCCACGACGCCATCGCCTTCTCCCCTGCGTTGACGGCGGCAGGGCAGTTCGGGTGCGTTTACTTTCTTCCCTGACGGAAGTAACCCTATACTGACGTCTT
CTATAGCGGCGGAGGTGCTGGTAAGTCCTCGGAAATCATACCGCCGGCGGGCATCATCTAATCACGTTCCAGACGGCTCGATCATGGCCCACACCGACGTCGAGATTCAGTACGCCGCCA
ACAACGGCCTTGACGAGATCATCGAGGAGCAGCGCCCCTTCGCGCTCAAGCACAACGTGTCCTTCGGCGACTT
GTAAGCACCGCTCGCATCTTGCACTCAAATTGGTGCGTCCGGGAATC
AGCTTCTAACTGCGCCCTAACAGCATCCAGTTCGCGGGAGCGGTCGGTGTGTCGAACTGCAACGGTGGCCCGCAAATCGGGTTCTTCGCCGGTCGCTCGAACGACTCGCAGCCCGCGCCC
GACAACCTCGTCCCCCTCCCGAGCGACTCCGTCACCGACATCCTCGCACGTGTCGCCGACGCGGGCTTCGCGCCCGTCGAGCTCGTCTGGATGCTGATCTCGCACACGGTCGCCGCGCAG
GACAAGGTTGACGAC
GTAAGTCCGCTTCTCTCCACCTCGAGGCCCCATCCCGCGTGCTTCGCATCCTGCGAACGTCGGGGTGGGACAGGTGCCAGTGGTATCAACGATCTCGTGCCGGCG
CTGACGTGTTTGACCGAACGCAGTCCATCCCCGGCACGCCCTTCGACTCCACCCCGAGCGACTTCGACGCCCAGTTCTTCGTCGAGTCGATGCTCAACGGCACCCTCACCCCCGGCAGCG
CCCTCCACGACGGCGAGGTCCAGTCGCCCCTCCCCGGAGAGTTCCGTCTTCAGTCCGACTTCCTCATCGGCCG
GTGAGTTATTCTTCGTCGTCGCCGTGCCTTGTCAGGGCACGGAGAAG
GGAGTGCGCACGCTAACTTCGCCGTCCAGGGACTCCCGCACCTCGTGCGAGTGGCAGAAGATGATCGGTACGTAACCGTCTACGATTCTATCCCTCGATGCCGCCGGGCTGACCGTCTCC
CCCACAGCCGACCGCGCAAACATGCTCCAGAAGTTCGAGCAGACCGTGCTCAAGCTGTCCCTGCTCGGGTTCTCTCAGTCGGCGCTCACTGACTGCTCGGACGTCATCCCGATCGCGACC
GGCACGGTCGCGGACCCCTTCCTCCCCGCGGGCAAGACGATGGCCGACATTGAGGCTGCGTGCGCTGCCACGCCCTTCCCTACGCTCTCTGCCGCGCCTG
GTAAGTTCCCTGCAGCTCAC
ATAACAGAATGCGAGCTGATCGGACGTTCTTGTGTTCTGACAGGTCCTGAGACCACCATCCCTGCCGTGTAAGTGATATCTGTCTTCGAGGGCGGTGCGAGATGCTGACGATGTTCTTCC
CCGCAGCCCCCTCGACTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTTCTCCAAGGCCCTCCTCTCCATCGTCGCTCTCGCTGCGTCCTTCACCGCTGCTGTCCCGTCCGCCAACAAGCGGGCTACCTGCAGCGGCGGTCAGACCACTGCTAACGATGCGTGCT
GCGTGTGGTTCGACGTCCTCGACGACATTCAGAGCAACCT
CTTCCACGGCGGCGAGTGTGGCGAGAACGCCCACGAATCTCTCCGGCTCATCTTCCACGACGCCATCGCCTTCTCCCCTG
CGTTGACGGCGGCAGGGCAGTTCGG
CGGCGGAGGTGCTGACGGCTCGATCATGGCCCACACCGACGTCGAGATTCAGTACGCCGCCAACAACGGCCTTGACGAGATCATCGAGGAGCAGC
GCCCCTTCGCGCTCAAGCACAACGTGTCCTTCGGCGACTT
CATCCAGTTCGCGGGAGCGGTCGGTGTGTCGAACTGCAACGGTGGCCCGCAAATCGGGTTCTTCGCCGGTCGCTCGAACG
ACTCGCAGCCCGCGCCCGACAACCTCGTCCCCCTCCCGAGCGACTCCGTCACCGACATCCTCGCACGTGTCGCCGACGCGGGCTTCGCGCCCGTCGAGCTCGTCTGGATGCTGATCTCGC
ACACGGTCGCCGCGCAGGACAAGGTTGACGAC
TCCATCCCCGGCACGCCCTTCGACTCCACCCCGAGCGACTTCGACGCCCAGTTCTTCGTCGAGTCGATGCTCAACGGCACCCTCACCC
CCGGCAGCGCCCTCCACGACGGCGAGGTCCAGTCGCCCCTCCCCGGAGAGTTCCGTCTTCAGTCCGACTTCCTCATCGGCCG
GGACTCCCGCACCTCGTGCGAGTGGCAGAAGATGATCG
CCGACCGCGCAAACATGCTCCAGAAGTTCGAGCAGACCGTGCTCAAGCTGTCCCTGCTCGGGTTCTCTCAGTCGGCGCTCACTGACTGCTCGGACGTCATCCCGATCGCGACCGGCACGG
TCGCGGACCCCTTCCTCCCCGCGGGCAAGACGATGGCCGACATTGAGGCTGCGTGCGCTGCCACGCCCTTCCCTACGCTCTCTGCCGCGCCTG
GTCCTGAGACCACCATCCCTGCCGTCC
CCCTCGACTCGTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGAGGACTTC ACCAACAAAC GACACTCGTC GACGACTCGC AGGACAGCAC TCGGGACCGC TTCAGCACGC TTGCATTCGA CGACCTTCAT CATGTTCTCC AAGGCCCTCC TCTCCATCGT  CGCTCTCGCT GCGTCCTTCA CCGCTGCTGT CCCGTCCGCC AACAAGCGGG CTACCTGCAG CGGCGGTCAG ACCACTGCTA ACGATGCGTG CTGCGTGTGG TTCGACGTCC TCGACGACAT  TCAGAGCAAC CTCTTCCACG GCGGCGAGTG TGGCGAGAAC GCCCACGAAT CTCTCCGGCT CATCTTCCAC GACGCCATCG CCTTCTCCCC TGCGTTGACG GCGGCAGGGC AGTTCGGCGG  CGGAGGTGCT GACGGCTCGA TCATGGCCCA CACCGACGTC GAGATTCAGT ACGCCGCCAA CAACGGCCTT GACGAGATCA TCGAGGAGCA GCGCCCCTTC GCGCTCAAGC ACAACGTGTC  CTTCGGCGAC TTCATCCAGT TCGCGGGAGC GGTCGGTGTG TCGAACTGCA ACGGTGGCCC GCAAATCGGG TTCTTCGCCG GTCGCTCGAA CGACTCGCAG CCCGCGCCCG ACAACCTCGT  CCCCCTCCCG AGCGACTCCG TCACCGACAT CCTCGCACGT GTCGCCGACG CGGGCTTCGC GCCCGTCGAG CTCGTCTGGA TGCTGATCTC GCACACGGTC GCCGCGCAGG ACAAGGTTGA  CGACTCCATC CCCGGCACGC CCTTCGACTC CACCCCGAGC GACTTCGACG CCCAGTTCTT CGTCGAGTCG ATGCTCAACG GCACCCTCAC CCCCGGCAGC GCCCTCCACG ACGGCGAGGT  CCAGTCGCCC CTCCCCGGAG AGTTCCGTCT TCAGTCCGAC TTCCTCATCG GCCGGGACTC CCGCACCTCG TGCGAGTGGC AGAAGATGAT CGCCGACCGC GCAAACATGC TCCAGAAGTT  CGAGCAGACC GTGCTCAAGC TGTCCCTGCT CGGGTTCTCT CAGTCGGCGC TCACTGACTG CTCGGACGTC ATCCCGATCG CGACCGGCAC GGTCGCGGAC CCCTTCCTCC CCGCGGGCAA  GACGATGGCC GACATTGAGG CTGCGTGCGC TGCCACGCCC TTCCCTACGC TCTCTGCCGC GCCTGGTCCT GAGACCACCA TCCCTGCCGT CCCCCTCGAC TCGTAAGATG CGGTAACACT  ATATGGTGGC GGGCAGTAAT GTCTGGCACG ATGAACGAAC TTGATTGGAA GTAGATAACT TTATGATCCT TGGTATTATG GTGGAACTTG AAGGGCTTCG CGTACGAGCT GATTAGGTCT 
ATTTGTTGAA CGTGATGTGA TACGCTATCG TCTTCGAAAT GCATTCCCTG 

Retrieve as FASTA