Entry information : TvVP02(VP3-atypical)
Entry ID 8529
Creation 2011-09-23 (Christophe Dunand)
Last sequence changes 2011-09-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: TvVP02(VP3-atypical)
Name TvVP02(VP3-atypical)
Class Versatile peroxidase     [Orthogroup: VP001]*
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvVP02
start..stop
S start..stop
TvVP01 504 1e-180 1..367 1..364
TvCIIBA03_Gangwondo 503 3e-180 1..367 1..364
TvCIIBA03_CU1 498 4e-178 1..367 1..362
GapCIIBA01 475 3e-169 1..367 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 221083..221196 114 N° 2 221250..221293 44 N° 3 221350..221395 46 N° 4 221456..221514 59
N° 5 221570..221583 14 N° 6 221635..221755 121 N° 7 221807..222041 235 N° 8 222096..222271 176
N° 9 222326..222363 38 N° 10 222426..222641 216 N° 11 222709..222733 25 N° 12 222788..222803 16
join(221083..221196,221250..221293,221350..221395,221456..221514,221570..221583, 221635..221755,221807..222041,222096..222271,222326..222363,222426..222641,22270 9..222733,222788..222803)


exon

Literature and cross-references TvVP02(VP3-atypical)
DNA ref. JGI genome:   scaffold_6 (221083..222803)
Protein sequence: TvVP02(VP3-atypical)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367 (349)
PWM (Da):   %s   38018.56 (36182.6)  
PI (pH):   %s   4.02 (3.98) Peptide Signal:   %s   cut: 19 range:19-367
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFPKTLLSFAMLAATAAAIPSANKRATCSGGQTTANEACCVWFDVLDDIQTNLFHDGTCGEEAHEALLIFHDAIAISPALTAQGQFGGGGDGSIMAHVDVEGAYHANNGLDEIIESERPFALKHNVSFGDFIQFAGAVGASNCNGGPQIPFFAGRSNDSQPAPDGLVPLPTDDVTTILDRIGDAGGFVAVELVWLLISHTVASQHTIDSVPGAPFDSTPSDFDAQFFVETLLNGTAPTGSTLESANGEALSPIPGEFRLASDSLIARDSRTACEWQRLTDPDDMVAKFVQTVQKLSLLGFDQSILTDCSDVIPAPSGSPAAGVLPAGKSFDDIQASCTTSAFPTTIATLSGPETSIAPVPTNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCCCAAGACCCTCCTCTCCTTCGCCATGCTGGCTGCGACAGCCGCTGCGATCCCGTCCGCCAACAAGCGGGCGACTTGCAGCGGTGGTCAGACCACAGCGAACGAGGCGGTGAGT
GCAATTTTCTCTGTTAAACACGCTTTCGATGCTCATGCCACATACAGTGCTGTGTATGGTTCGATGTTCTTGACGACATCCAAACCAACCTGTAAGCCTCGTATCGATGTTAACATACAG
GTTTCGCTCATCGGGGGCTATTCGCAGGTTCCACGACGGCACTTGTGGCGAGGAAGCCCACGAGGCTTTGCGGGTACATATCCCTCGATGCCTTACAAATACAATCTGATATCGATATCA
TCTGGTTCTTTAGCTCATCTTCCACGATGCCATTGCCATTTCCCCTGCCTTGACCGCCCAAGGACAGTTCGGGTGCGCTTTATCTCAGTTCATGCTTTTTGATCATGGCGACTAACCCTG
ATTCCAGTGGCGGAGGTGCAGGTACGTTGAGCGGACACCCATTCTCGGCGTCACAACCTAACTTTCCTACAGATGGTTCGATCATGGCGCACGTCGATGTTGAGGGGGCTTATCACGCCA
ACAATGGCCTGGACGAGATCATCGAGTCCGAGCGTCCCTTCGCCCTCAAGCACAACGTCTCCTTTGGTGATTT
GTGCGTTCTTTATTATCAAGGTCGTATCGCACTCTGACAGCGTGGCT
CTAGCATCCAGTTTGCGGGTGCCGTCGGCGCCTCGAATTGCAACGGTGGTCCCCAAATTCCGTTCTTTGCGGGGCGGTCCAACGACTCGCAGCCGGCCCCAGACGGCCTTGTCCCTCTGC
CGACCGACGATGTTACGACGATTCTTGACCGCATTGGCGACGCCGGCGGCTTTGTGGCTGTCGAGCTCGTCTGGCTGCTCATCTCGCACACCGTTGCCTCTCAGCACACCATCGACCCC
G
TGAGTTTCCTTCTGCCACTCGGAGATAGTGCGGGAGGCTGACTGCCGCTGTAGTCCGTTCCTGGCGCGCCGTTCGATTCGACGCCGTCCGATTTCGACGCCCAGTTCTTCGTGGAGACCC
TTCTGAACGGCACCGCGCCTACTGGAAGCACCCTGGAGTCTGCTAACGGCGAAGCGCTTTCGCCTATTCCTGGTGAGTTCCGCCTGGCGTCGGACTCTCTCATCGCTAG
GTATGTATTTG
GTACAATCTGTCTGAAGTATCTGGACACTGAGACGCATCTCAGGGATAGCCGCACGGCCTGCGAGTGGCAGAGGTTGATCAGTGCGTTCTCACATAACGTGTCGCAATCTTTGGCTGACT
GACCGCCGTGATCGCATACACAGCCGACCCCGACGACATGGTGGCGAAGTTCGTGCAGACCGTCCAGAAGTTGTCTCTCCTCGGCTTTGACCAAAGCATCCTCACCGACTGCTCTGACGT
CATCCCCGCCCCGTCCGGCTCCCCTGCGGCTGGTGTCTTGCCCGCCGGCAAGTCCTTCGACGACATCCAGGCCTCCTGCACTACCTCTGCTTTCCCCACCACCATCGCTACTCTGTCCG
G
TAAGTCTTTGTTCGTTTACAATGCCGGTTCCTCCGTGTTCTGACATTTCGTCATGCTTCGCTCTAGGCCCGGAGACATCCATTGCTCCCGTGTAAGTGCTGCCAGCGCACCTATCTTGCC
GCATTATTAATGTGTCGTTTCGTAGCCCTACTAACTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCCCAAGACCCTCCTCTCCTTCGCCATGCTGGCTGCGACAGCCGCTGCGATCCCGTCCGCCAACAAGCGGGCGACTTGCAGCGGTGGTCAGACCACAGCGAACGAGGCGTGCTGT
GTATGGTTCGATGTTCTTGACGACATCCAAACCAACCT
GTTCCACGACGGCACTTGTGGCGAGGAAGCCCACGAGGCTTTGCGGCTCATCTTCCACGATGCCATTGCCATTTCCCCTGCC
TTGACCGCCCAAGGACAGTTCGG
TGGCGGAGGTGCAGATGGTTCGATCATGGCGCACGTCGATGTTGAGGGGGCTTATCACGCCAACAATGGCCTGGACGAGATCATCGAGTCCGAGCGT
CCCTTCGCCCTCAAGCACAACGTCTCCTTTGGTGATTT
CATCCAGTTTGCGGGTGCCGTCGGCGCCTCGAATTGCAACGGTGGTCCCCAAATTCCGTTCTTTGCGGGGCGGTCCAACGAC
TCGCAGCCGGCCCCAGACGGCCTTGTCCCTCTGCCGACCGACGATGTTACGACGATTCTTGACCGCATTGGCGACGCCGGCGGCTTTGTGGCTGTCGAGCTCGTCTGGCTGCTCATCTCG
CACACCGTTGCCTCTCAGCACACCATCGACCCC
TCCGTTCCTGGCGCGCCGTTCGATTCGACGCCGTCCGATTTCGACGCCCAGTTCTTCGTGGAGACCCTTCTGAACGGCACCGCGCCT
ACTGGAAGCACCCTGGAGTCTGCTAACGGCGAAGCGCTTTCGCCTATTCCTGGTGAGTTCCGCCTGGCGTCGGACTCTCTCATCGCTAG
GGATAGCCGCACGGCCTGCGAGTGGCAGAGG
TTGATCA
CCGACCCCGACGACATGGTGGCGAAGTTCGTGCAGACCGTCCAGAAGTTGTCTCTCCTCGGCTTTGACCAAAGCATCCTCACCGACTGCTCTGACGTCATCCCCGCCCCGTCC
GGCTCCCCTGCGGCTGGTGTCTTGCCCGCCGGCAAGTCCTTCGACGACATCCAGGCCTCCTGCACTACCTCTGCTTTCCCCACCACCATCGCTACTCTGTCCG
GCCCGGAGACATCCATT
GCTCCCGT
CCCTACTAACTCCTAA

Retrieve as FASTA