Entry information : RrufCIIAB01
Entry ID 8540
Creation 2011-09-26 (Christophe Dunand)
Last sequence changes 2011-09-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: RrufCIIAB01
Name RrufCIIAB01
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Patellariaceae Rhytidhysteron
Organism Rhytidhysteron rufulum    [TaxId: 37885 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RrufCIIAB01
start..stop
S start..stop
HEC38CIIAB01 331 1e-114 31..273 21..263
LfluCIIAB03 314 7e-108 20..276 1..256
HCO27CIIAB01 311 1e-106 31..273 21..263
DescCIIAB01 310 2e-106 31..273 21..267
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27945..28308 364 N° 2 28364..28974 611  
join(27945..28308,28364..28974)


exon

Literature and cross-references RrufCIIAB01
DNA ref. JGI genome:   NODE_652_length_57652_cov_40.976635 (27945..28974)
Protein sequence: RrufCIIAB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (305)
PWM (Da):   %s   33558.15 (31537.1)  
PI (pH):   %s   4.1 (4.05) Peptide Signal:   %s   cut: 20 range:20-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYTLPLLAATLCVVRFASAIRNDASSLDRRQSSCPSVWTDVAEDLKTTFIGEDGGCTDDARTAIRLAFHDCFPGACDGSIILSDECTARGENTQLVGICGTIGDKATQFNVSTADMIQFGAAIGIAACPGGPAIPFYAGRVDDSNANPENQLPSPSANASFMLERFVAKGFSATDLVALVGAHTTAKQLSGTALDSTPGSWDVDFYSETSQRTAPSSLDSDLSLSNSSETSGAWQKVGASTSAFADAFIPAMEKMSLIGNDKASLVDCSDVISSIATGSIKQKGADNEETGKEEEVSGSGTVQPQSGSVWAIIFACSIIITIML

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACACCCTTCCCTTGTTGGCGGCAACTCTTTGTGTTGTTCGGTTTGCGAGCGCGATACGTAATGATGCATCGTCCTTGGACAGACGGCAGTCGAGCTGCCCTTCTGTTTGGACGGAT
GTTGCGGAGGACTTGAAGACAACATTCATTGGGGAAGACGGTGGTTGCACTGATGATGCCCGCACGGCTATTCGACTCGCATTCCACGATTGCTTTCCAGGCGCATGCGATGGTTCCATT
ATTCTGTCCGACGAATGCACTGCCCGAGGGGAGAACACACAATTGGTTGGTATCTGTGGAACAATAGGGGACAAGGCAACTCAATTCAACGTCAGCACGGCGGATATGATCCAGTTTGGA
GCAG
GTACGTTGATCTACCCATCTCACTCACTCATCAGCTGACGTCTTCGTTTTCAAAGCAATTGGGATTGCCGCTTGTCCTGGAGGCCCGGCCATTCCTTTCTATGCTGGCCGTGTTGA
CGACAGCAACGCCAACCCCGAGAATCAGCTTCCATCCCCTTCGGCCAATGCCTCCTTCATGCTAGAGCGGTTCGTCGCAAAGGGCTTCTCTGCCACCGATCTCGTCGCTTTAGTCGGCGC
CCATACAACCGCGAAGCAGTTATCTGGAACTGCCTTGGATTCAACGCCAGGCTCTTGGGATGTTGACTTCTATTCCGAAACATCGCAGAGGACAGCACCTTCTAGCTTAGACAGCGATCT
CTCTCTGAGTAACTCCAGCGAGACAAGCGGCGCATGGCAGAAGGTAGGAGCAAGTACCTCAGCCTTTGCGGATGCATTCATCCCGGCGATGGAGAAGATGAGCCTGATTGGAAACGACAA
AGCAAGTCTGGTAGATTGTTCAGATGTGATCAGCAGTATTGCTACAGGGTCGATCAAACAAAAGGGTGCAGATAACGAGGAGACAGGGAAGGAAGAAGAGGTATCCGGCTCAGGCACTGT
TCAGCCACAGTCCGGTAGTGTGTGGGCCATCATATTCGCCTGTTCTATCATCATCACAATAATGTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACACCCTTCCCTTGTTGGCGGCAACTCTTTGTGTTGTTCGGTTTGCGAGCGCGATACGTAATGATGCATCGTCCTTGGACAGACGGCAGTCGAGCTGCCCTTCTGTTTGGACGGAT
GTTGCGGAGGACTTGAAGACAACATTCATTGGGGAAGACGGTGGTTGCACTGATGATGCCCGCACGGCTATTCGACTCGCATTCCACGATTGCTTTCCAGGCGCATGCGATGGTTCCATT
ATTCTGTCCGACGAATGCACTGCCCGAGGGGAGAACACACAATTGGTTGGTATCTGTGGAACAATAGGGGACAAGGCAACTCAATTCAACGTCAGCACGGCGGATATGATCCAGTTTGGA
GCAG
CAATTGGGATTGCCGCTTGTCCTGGAGGCCCGGCCATTCCTTTCTATGCTGGCCGTGTTGACGACAGCAACGCCAACCCCGAGAATCAGCTTCCATCCCCTTCGGCCAATGCCTCC
TTCATGCTAGAGCGGTTCGTCGCAAAGGGCTTCTCTGCCACCGATCTCGTCGCTTTAGTCGGCGCCCATACAACCGCGAAGCAGTTATCTGGAACTGCCTTGGATTCAACGCCAGGCTCT
TGGGATGTTGACTTCTATTCCGAAACATCGCAGAGGACAGCACCTTCTAGCTTAGACAGCGATCTCTCTCTGAGTAACTCCAGCGAGACAAGCGGCGCATGGCAGAAGGTAGGAGCAAGT
ACCTCAGCCTTTGCGGATGCATTCATCCCGGCGATGGAGAAGATGAGCCTGATTGGAAACGACAAAGCAAGTCTGGTAGATTGTTCAGATGTGATCAGCAGTATTGCTACAGGGTCGATC
AAACAAAAGGGTGCAGATAACGAGGAGACAGGGAAGGAAGAAGAGGTATCCGGCTCAGGCACTGTTCAGCCACAGTCCGGTAGTGTGTGGGCCATCATATTCGCCTGTTCTATCATCATC
ACAATAATGTTGTAA

Retrieve as FASTA