Entry information : RrufCIIAA03
Entry ID 8542
Creation 2011-09-26 (Christophe Dunand)
Last sequence changes 2011-09-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: RrufCIIAA03
Name RrufCIIAA03
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Patellariaceae Rhytidhysteron
Organism Rhytidhysteron rufulum    [TaxId: 37885 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RrufCIIAA03
start..stop
S start..stop
LfluCIIAA04 580 0 1..396 1..392
ClunCIIAA01 566 0 1..399 1..399
COsaCIIAA05 565 0 1..399 1..399
CheCIIAA05_C5 562 0 1..399 1..399
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3287..4276 990 N° 2 2952..3194 243  
complement(join(2952..3194,3287..4276))


exon

Literature and cross-references RrufCIIAA03
DNA ref. JGI genome:   NODE_1246_length_22772_cov_61.276524 (4276..2952)
Protein sequence: RrufCIIAA03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   411 (390)
PWM (Da):   %s   44097.27 (41769.9)  
PI (pH):   %s   5.41 (4.93) Peptide Signal:   %s   cut: 22 range:22-411
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRALRFLPSLALLLLLPNSHAYPGMKDTVADLHKLARADLNPRNSKELIGDLKTLKDSQLTKIGKDIKAILLGTATAESNVIDAGIPAGNLGSDACNKDLCCVWKWISYEMTAAFNGTSGRCTKFARGAVRLGFHDAAVWSTSTSYGGADGSILLSDEMSRSDNDGLADIAAKMKGWYDKYNQYGVSMADLIQMGANVATVVCPLGPRLRSFVGRKDNSKAGPTGLLPDVNDSADTLINLFKAKTIDATDLVALVGAHTTSQQHFVDQTRDGDPQDSTPGIWDVAFYGQTTSPIYPPRVFKFASDEKLSTDSRTVAPWLAFVGLQGAWNAAYATAYTRMSLLGVNNINDLQECTKVLPPARTTFISLDQPILDLWLQGLYDQLNDLVDNAIMLTGVTGGTTPPEAHVDSGK

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGCTCTTCGTTTCCTCCCGAGCTTGGCGCTCCTCCTCCTCCTACCTAACTCCCATGCATACCCTGGCATGAAAGATACCGTCGCTGATCTCCATAAACTCGCCCGCGCCGACCTC
AACCCACGAAACTCCAAAGAACTTATCGGCGACCTCAAAACCCTCAAAGACTCCCAACTGACCAAGATCGGCAAAGACATCAAAGCGATCCTCCTGGGTACCGCGACAGCAGAGTCCAAC
GTCATTGATGCAGGTATACCAGCGGGAAACTTGGGCTCCGACGCATGCAACAAGGATCTCTGCTGCGTCTGGAAATGGATCTCGTATGAGATGACGGCGGCTTTCAACGGCACCTCTGGG
CGCTGTACGAAGTTTGCTCGTGGTGCTGTAAGATTGGGCTTTCATGATGCGGCCGTTTGGAGTACAAGTACAAGTTATGGAGGTGCTGATGGGAGTATCTTGCTCAGCGATGAGATGAGT
AGGAGCGATAATGATGGGCTGGCGGACATCGCGGCGAAGATGAAAGGATGGTATGACAAGTACAATCAATACGGAGTCAGCATGGCAGATCTGATTCAGATGGGAGCGAACGTCGCTACA
GTCGTCTGTCCACTTGGTCCACGACTACGATCCTTCGTTGGCAGGAAGGACAATTCCAAAGCTGGTCCGACAGGGCTCTTACCCGATGTCAACGACTCTGCAGACACGTTGATTAATTTG
TTCAAGGCAAAGACTATTGATGCTACGGACCTTGTTGCTTTGGTTGGTGCACACACGACTAGTCAGCAGCACTTCGTGGACCAAACCAGAGATGGAGATCCACAGGATTCAACACCAGGG
ATATGGGACGTGGCTTTCTATGGTCAAACTACCTCGCCTATCTATCCACCTCGGGTGTTCAAGTTCGCCAGTGACGAGAAGCTATCTACGGATTCACGAACGGTGGCTCCTTGGCTAGCA
TTCGTAGGTCTGCAAGGCGCATGGAATGCT
GTAAGTCATGTCTCCGAGTTCTCCGTCCTCATTACTTCATTCCCTTCCCAGTGATGCATCAACTTCTATGGCTTCTAACACTCTTCTTCC
AGGCTTACGCGACGGCTTATACCCGTATGTCTCTTCTCGGCGTGAACAACATCAACGACCTCCAAGAATGTACCAAGGTTCTTCCACCCGCACGAACGACATTCATAAGTCTGGATCAAC
CAATTCTCGATCTTTGGTTGCAGGGGCTATATGACCAATTGAATGATCTTGTGGATAACGCGATAATGCTTACGGGAGTGACTGGAGGAACGACTCCACCGGAAGCCCACGTGGATTCAG
GGAAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGCTCTTCGTTTCCTCCCGAGCTTGGCGCTCCTCCTCCTCCTACCTAACTCCCATGCATACCCTGGCATGAAAGATACCGTCGCTGATCTCCATAAACTCGCCCGCGCCGACCTC
AACCCACGAAACTCCAAAGAACTTATCGGCGACCTCAAAACCCTCAAAGACTCCCAACTGACCAAGATCGGCAAAGACATCAAAGCGATCCTCCTGGGTACCGCGACAGCAGAGTCCAAC
GTCATTGATGCAGGTATACCAGCGGGAAACTTGGGCTCCGACGCATGCAACAAGGATCTCTGCTGCGTCTGGAAATGGATCTCGTATGAGATGACGGCGGCTTTCAACGGCACCTCTGGG
CGCTGTACGAAGTTTGCTCGTGGTGCTGTAAGATTGGGCTTTCATGATGCGGCCGTTTGGAGTACAAGTACAAGTTATGGAGGTGCTGATGGGAGTATCTTGCTCAGCGATGAGATGAGT
AGGAGCGATAATGATGGGCTGGCGGACATCGCGGCGAAGATGAAAGGATGGTATGACAAGTACAATCAATACGGAGTCAGCATGGCAGATCTGATTCAGATGGGAGCGAACGTCGCTACA
GTCGTCTGTCCACTTGGTCCACGACTACGATCCTTCGTTGGCAGGAAGGACAATTCCAAAGCTGGTCCGACAGGGCTCTTACCCGATGTCAACGACTCTGCAGACACGTTGATTAATTTG
TTCAAGGCAAAGACTATTGATGCTACGGACCTTGTTGCTTTGGTTGGTGCACACACGACTAGTCAGCAGCACTTCGTGGACCAAACCAGAGATGGAGATCCACAGGATTCAACACCAGGG
ATATGGGACGTGGCTTTCTATGGTCAAACTACCTCGCCTATCTATCCACCTCGGGTGTTCAAGTTCGCCAGTGACGAGAAGCTATCTACGGATTCACGAACGGTGGCTCCTTGGCTAGCA
TTCGTAGGTCTGCAAGGCGCATGGAATGCT
GCTTACGCGACGGCTTATACCCGTATGTCTCTTCTCGGCGTGAACAACATCAACGACCTCCAAGAATGTACCAAGGTTCTTCCACCCGCA
CGAACGACATTCATAAGTCTGGATCAACCAATTCTCGATCTTTGGTTGCAGGGGCTATATGACCAATTGAATGATCTTGTGGATAACGCGATAATGCTTACGGGAGTGACTGGAGGAACG
ACTCCACCGGAAGCCCACGTGGATTCAGGGAAA

Retrieve as FASTA