Entry information : AcoPrx11 (AcoGoldSmith_v1.007591m)
Entry ID 8575
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx11 (AcoGoldSmith_v1.007591m)
Name (synonym) AcoPrx11 (AcoGoldSmith_v1.007591m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx11
start..stop
S start..stop
AfpPrx19 725 0 1..353 1..353
AcoPrx12 628 0 21..353 21..352
AfpPrx26 624 0 21..353 21..352
AcoPrx10 510 0 2..353 3..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3455091..3455336 246 N° 2 3455606..3455800 195 N° 3 3456048..3456668 621  
join(3455091..3455336,3455606..3455800,3456048..3456668)


exon

Literature and cross-references AcoPrx11 (AcoGoldSmith_v1.007591m)
DNA ref. Phytozome 12:   scaffold_23 (3455091..3456668)
Protein sequence: AcoPrx11 (AcoGoldSmith_v1.007591m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (326)
PWM (Da):   %s   38451.53 (35530.0)  
PI (pH):   %s   8.72 (8.72) Peptide Signal:   %s   cut: 28 range:28-353
Sequence 395
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTTSLISLLLLSSIFLSSHLSLTSAQSTPPLVGGLSWNFYKSNCPKLEKIVRDELKKAFKRDIGIAAGLLRIHFHDCFVQGCDGSVLLAGSASGPGEQEAPPNLTLRPQAFTVINEIRNKIHKACGQVVSCSDITALAARDSVFLSGGPNYRVPLGRRDGLTFATRNATLENLPFFGSSARELIAAVATKGLDATDLVAISGGHTIGRGNCGSFTARLYPNQDVNMDQTYANNLKRICPALNSNGSTVLDIRSPNVFDNKYYVDLMNRQGLFMSDQDLYTDRTTRPIVTSFAINQTLFYERFAFSMIKMSMLNVLTGTQGEIRANCSRRNAARTYVTTLVDEDQEGKSASF*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCTCCACTACTTCACTAATCTCTCTTCTCTTACTCTCTTCTATTTTTCTTAGTTCCCATTTGTCTCTAACAAGTGCACAATCCACACCACCTTTAGTAGGGGGACTTTCATGGAATT
TCTATAAGTCTAATTGTCCTAAGTTGGAGAAAATTGTTAGAGATGAACTTAAGAAGGCTTTCAAGAGGGATATTGGTATAGCTGCAGGCTTGCTTAGGATCCATTTCCATGACTGCTTTG
TTCAG
GTACTTGCTAATGTTTGCCTTTCATTCATATGTCACAATTTTTGTTTGGTCTATATATGGCAACAATCTATGTAAGACCTAAATACCTTACAGGCTTACACACACATTTCCTCTT
TTAATGTCTTCTTCCTGTATCAAATTCAACTTCATATGAGACTTTGGGATGGAGATTATGTTGTTTGTTCATTCTTTTTGATGAAATTGATAAGGCAAACATTGAAATTGTCTGACCAGT
TAACATATATCAACTGTTATCTATTTATCTGTAGGGATGTGATGGCTCAGTGCTGTTAGCTGGGTCAGCAAGTGGTCCAGGAGAACAAGAAGCACCACCAAACTTGACACTCAGACCCCA
AGCATTTACTGTCATTAATGAAATTCGGAACAAGATTCATAAAGCTTGTGGTCAAGTCGTTTCTTGTTCGGACATCACTGCTCTAGCTGCTCGCGATTCTGTTTTCCTG
GTAACATTACA
CTACCTATATTGCTCTTAGACCTATACTGATTACTGAACTACAACTATTCCAAATTCAAAGATACACCCATTTTGATCATGTTTTATAGTATTTTATATGGGACTAGAAATTGATATATT
CATAAATAAATTTCCCAACTCTTTGTTTAAACTTCATGCCATTCTTGTAGAAATGTCATTAAAATGGTGAATGCAAAATGCCAAAATCGCAAACTAATTAAATCCTGCTAATGCAGTCAG
GAGGCCCGAATTACAGAGTTCCTTTGGGCAGGCGTGATGGGCTCACTTTTGCAACAAGAAATGCAACGCTTGAAAACCTTCCATTTTTTGGTTCCTCTGCAAGGGAGCTCATTGCTGCTG
TAGCAACCAAGGGCTTAGATGCAACCGATCTAGTGGCTATCTCAGGTGGTCACACCATTGGCCGTGGTAATTGTGGATCGTTCACTGCACGTTTGTACCCCAACCAGGATGTAAACATGG
ACCAAACATATGCGAATAACCTTAAACGCATATGCCCTGCACTCAATTCCAATGGCTCCACTGTGTTAGATATTCGATCTCCAAACGTATTTGACAACAAATACTATGTAGATCTCATGA
ATCGGCAAGGTCTTTTCATGTCCGACCAAGACTTGTACACTGACAGAACTACTAGACCTATTGTCACAAGCTTTGCCATCAACCAAACTCTGTTCTACGAAAGGTTTGCATTTTCCATGA
TTAAGATGAGTATGTTGAATGTGTTAACTGGGACACAAGGTGAGATACGTGCCAATTGCTCACGTCGCAATGCTGCTAGGACATATGTAACAACTCTAGTGGATGAGGATCAAGAAGGGA
AGAGTGCATCATTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCTCCACTACTTCACTAATCTCTCTTCTCTTACTCTCTTCTATTTTTCTTAGTTCCCATTTGTCTCTAACAAGTGCACAATCCACACCACCTTTAGTAGGGGGACTTTCATGGAATT
TCTATAAGTCTAATTGTCCTAAGTTGGAGAAAATTGTTAGAGATGAACTTAAGAAGGCTTTCAAGAGGGATATTGGTATAGCTGCAGGCTTGCTTAGGATCCATTTCCATGACTGCTTTG
TTCAG
GGATGTGATGGCTCAGTGCTGTTAGCTGGGTCAGCAAGTGGTCCAGGAGAACAAGAAGCACCACCAAACTTGACACTCAGACCCCAAGCATTTACTGTCATTAATGAAATTCGGA
ACAAGATTCATAAAGCTTGTGGTCAAGTCGTTTCTTGTTCGGACATCACTGCTCTAGCTGCTCGCGATTCTGTTTTCCTG
TCAGGAGGCCCGAATTACAGAGTTCCTTTGGGCAGGCGTG
ATGGGCTCACTTTTGCAACAAGAAATGCAACGCTTGAAAACCTTCCATTTTTTGGTTCCTCTGCAAGGGAGCTCATTGCTGCTGTAGCAACCAAGGGCTTAGATGCAACCGATCTAGTGG
CTATCTCAGGTGGTCACACCATTGGCCGTGGTAATTGTGGATCGTTCACTGCACGTTTGTACCCCAACCAGGATGTAAACATGGACCAAACATATGCGAATAACCTTAAACGCATATGCC
CTGCACTCAATTCCAATGGCTCCACTGTGTTAGATATTCGATCTCCAAACGTATTTGACAACAAATACTATGTAGATCTCATGAATCGGCAAGGTCTTTTCATGTCCGACCAAGACTTGT
ACACTGACAGAACTACTAGACCTATTGTCACAAGCTTTGCCATCAACCAAACTCTGTTCTACGAAAGGTTTGCATTTTCCATGATTAAGATGAGTATGTTGAATGTGTTAACTGGGACAC
AAGGTGAGATACGTGCCAATTGCTCACGTCGCAATGCTGCTAGGACATATGTAACAACTCTAGTGGATGAGGATCAAGAAGGGAAGAGTGCATCATTTTGA

Retrieve as FASTA