Entry information : AcoPrx36 (AcoGoldSmith_v1.008469m)
Entry ID 8593
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx36 (AcoGoldSmith_v1.008469m)
Name (synonym) AcoPrx36 (AcoGoldSmith_v1.008469m)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx36
start..stop
S start..stop
AfpPrx18 667 0 1..324 1..324
PtPrx51 497 4e-179 20..324 24..328
GmPrx182 494 5e-178 8..324 9..328
CpapPrx62 492 3e-177 8..324 18..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2893579..2893782 204 N° 2 2893879..2894076 198 N° 3 2894160..2894325 166 N° 4 2894425..2894831 407
join(2893579..2893782,2893879..2894076,2894160..2894325,2894425..2894831)


exon

Literature and cross-references AcoPrx36 (AcoGoldSmith_v1.008469m)
DNA ref. Phytozome 12:   scaffold_24 (2893579..2894831)
Protein sequence: AcoPrx36 (AcoGoldSmith_v1.008469m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (302)
PWM (Da):   %s   35400.02 (32785.6)  
PI (pH):   %s   8.89 (8.90) Peptide Signal:   %s   cut: 23 range:23-324
Sequence 366
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEYSRLSILFFFLPLLVTTASALQRNYYATTCPSVESIVRGAVTQKFRQTFVTVPGTLRLFFHDCFVRGCDASVLLASPNNNAEKDHADDVSLAGDGFDTVIKAKAAVDRDPKCKNKVSCADILALATRDVVVLAGGPSYDVELGRLDGKISTKASVQRKLPHPEFNLDQLNSMFSSNGLTQTDMIALSGAHTLGFSHCSKFSKRLYNFSPTSLVDPVINSNYVKQLKASCPRNVDATVAINMDPTTPQKFDNAYYKNLQQGMGLFSSDQVLFTDSRSRNTVNLFAANSTAFQQAFITAITKLGRVGVLTGKQGEIRRDCIAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGTATTCCAGACTCTCAATACTCTTCTTTTTCCTTCCTCTTCTCGTAACTACAGCTTCTGCTCTTCAACGCAATTATTATGCAACCACTTGTCCCAGTGTCGAGTCAATTGTTCGTG
GTGCAGTCACACAGAAGTTTCGGCAAACTTTTGTTACCGTTCCAGGGACACTTAGGCTCTTCTTCCATGACTGCTTCGTTCGG
GTTAGTATTAGTTTCTTCATTTTCTTGTTTGGTTTAG
ATTTTGTCATAACTCTTTATTACAGTATATAAGACAAGTACGTCCATTGTTTCTGGCAGGGGTGTGATGCTTCAGTTCTTCTTGCTTCACCTAATAACAACGCAGAGAAGGACCATGCTG
ACGATGTATCCCTTGCGGGTGATGGGTTTGACACTGTGATCAAAGCCAAAGCAGCAGTAGATAGAGATCCTAAATGCAAGAACAAGGTTTCATGTGCTGATATATTGGCCTTAGCCACTA
GAGATGTAGTTGTCTTG
GTATAAATGTTCCCAAAACACTCTTTAGTAATCATATGTATTTTCTCAGGGATGTGCCAAGTGATCGTAAAACTTTCTTGCAGGCTGGTGGACCATCTTATGA
TGTTGAACTGGGAAGGCTCGATGGGAAAATCTCTACTAAAGCTAGTGTCCAACGAAAACTTCCCCACCCTGAGTTCAATTTAGACCAGCTTAACTCCATGTTTTCCTCTAATGGGCTGAC
GCAGACGGATATGATCGCGCTATCAG
GTACTTAATTGAATATCAAATGAATCACTGTTCAATTAATTTAATATGAACATGTCCTAAGATTAAAGTTCATTAAGGTAATATCTGAATGTAT
TGTAGGAGCACATACACTGGGATTCTCTCATTGTAGCAAGTTCTCAAAAAGACTTTACAACTTCAGCCCAACAAGTCTGGTTGATCCTGTAATCAACTCGAATTACGTTAAACAACTTAA
AGCAAGCTGCCCAAGAAATGTAGACGCAACAGTAGCCATCAATATGGATCCTACAACACCTCAAAAATTTGACAATGCATATTACAAGAACCTGCAACAAGGAATGGGGTTGTTCAGTTC
TGATCAGGTATTGTTTACAGATTCAAGATCAAGGAACACGGTGAACCTGTTTGCCGCAAACAGCACAGCTTTCCAACAGGCTTTTATAACTGCAATTACAAAGTTGGGAAGAGTGGGGGT
TCTAACTGGAAAGCAAGGGGAGATTCGTCGCGATTGCATTGCTGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGTATTCCAGACTCTCAATACTCTTCTTTTTCCTTCCTCTTCTCGTAACTACAGCTTCTGCTCTTCAACGCAATTATTATGCAACCACTTGTCCCAGTGTCGAGTCAATTGTTCGTG
GTGCAGTCACACAGAAGTTTCGGCAAACTTTTGTTACCGTTCCAGGGACACTTAGGCTCTTCTTCCATGACTGCTTCGTTCGG
GGGTGTGATGCTTCAGTTCTTCTTGCTTCACCTAATA
ACAACGCAGAGAAGGACCATGCTGACGATGTATCCCTTGCGGGTGATGGGTTTGACACTGTGATCAAAGCCAAAGCAGCAGTAGATAGAGATCCTAAATGCAAGAACAAGGTTTCATGTG
CTGATATATTGGCCTTAGCCACTAGAGATGTAGTTGTCTTG
GCTGGTGGACCATCTTATGATGTTGAACTGGGAAGGCTCGATGGGAAAATCTCTACTAAAGCTAGTGTCCAACGAAAAC
TTCCCCACCCTGAGTTCAATTTAGACCAGCTTAACTCCATGTTTTCCTCTAATGGGCTGACGCAGACGGATATGATCGCGCTATCAG
GAGCACATACACTGGGATTCTCTCATTGTAGCA
AGTTCTCAAAAAGACTTTACAACTTCAGCCCAACAAGTCTGGTTGATCCTGTAATCAACTCGAATTACGTTAAACAACTTAAAGCAAGCTGCCCAAGAAATGTAGACGCAACAGTAGCCA
TCAATATGGATCCTACAACACCTCAAAAATTTGACAATGCATATTACAAGAACCTGCAACAAGGAATGGGGTTGTTCAGTTCTGATCAGGTATTGTTTACAGATTCAAGATCAAGGAACA
CGGTGAACCTGTTTGCCGCAAACAGCACAGCTTTCCAACAGGCTTTTATAACTGCAATTACAAAGTTGGGAAGAGTGGGGGTTCTAACTGGAAAGCAAGGGGAGATTCGTCGCGATTGCA
TTGCTGTGAACTAA

Retrieve as FASTA