Entry information : CclPrx02 (clementine0.9_014541m)
Entry ID 8648
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx02 (clementine0.9_014541m)
Name (synonym) CclPrx02 (clementine0.9_014541m)
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx02
start..stop
S start..stop
CsPrx62 709 0 1..349 1..349
CppPrx02 679 0 10..349 1..340
CclPrx20 662 0 1..349 1..349
CsPrx53 662 0 1..349 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1064250..1064465 216 N° 2 1063282..1063473 192 N° 3 1062352..1062520 169 N° 4 1061625..1062097 473
complement(join(1061625..1062097,1062352..1062520,1063282..1063473,1064250..1064 465))


exon

Literature and cross-references CclPrx02 (clementine0.9_014541m)
Literature Forment,J. et al., Development of a citrus genome-wide EST collection and cDNA microarray as resources for genomic studies, Plant Mol. Biol. 57 (3), 375-391 (2005).
DNA ref. Phytozome 12:   scaffold_31 (1064465..1061625)
Protein sequence: CclPrx02 (clementine0.9_014541m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (324)
PWM (Da):   %s   37800.02 (35080.5)  
PI (pH):   %s   7.68 (7.68) Peptide Signal:   %s   cut: 26 range:26-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRYLLAAALLVAFVLEGSPSQAQLSPSFYSSTCPNVLNTIEDVLKKAFSSDIRIGASLIRLHFHDCFVDGCDASILLDSTNTIDSEKFAAPNNNSARGFEVIDNMKAAVERACPRVVSCADILTIAAERSVALSGGPSWAVPLGRRDSRTANRALANQNLPGPFDTLDELKSSFRNVGLNDKLDLVALSGAHTFGRAQCQFFRGRLYDFNNTGKPDPTLDATFLQQLRKLCPQGGNGGVLANFDVTTPDVFDNKYFSNLRGRKGLLQSDQELFSTPGADTAAIVEDFGRNQNAFFKNFVTSMIRMGNLKPLTGNQGEIRLNCRRVNGNSNIATRSSSSEGDLVSSF*

Retrieve as FASTA  
Remarks Complete sequence from genomic. 15 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTCGTTATCTTCTCGCAGCAGCTCTTCTTGTTGCTTTTGTGCTTGAGGGATCACCATCTCAAGCTCAACTTTCTCCATCTTTTTATTCTTCCACATGCCCTAATGTATTG
AACACTATCGAGGATGTGCTTAAGAAAGCTTTCTCGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTGAT
GTAAGCAATCTCTGCTCTCTCATT
TTTCATATTCTTTACTTTATCAAGCTCTCTGTCCATGTACTTACTGATATAACATAGTTTCAAGTATGTCAATGAACAGTATCTTTATAATTTTTTATGGCATTAAACAAAATATAGAGT
TTTCATAAAGCCTAAGGAAGAGTTTGAATATATCATTTTATGTTCAACAACTTCCAAAACCATTTATATATATTTTCTCTTTTATCTGTCTGCTACTCATTGCATTCTTCTTCTGACCGC
ATATTCATGCACGTAGAGATCCTCACCCCCAACCCCAAGCTAAAAGATCTGATTTTTTCGCTTCAGCCGTACAACAAAACTTTCCTCTCTAATTTGGATGTACCGAAGACCATGTAATTC
NNNNNNNNNNNNNNNNNNNNNNNNNGGGGTTTTCATGCACTAAAAATTTTAATCTAGTAAAGATTTGGTCCAAAACAGGAATTAAAATCCATCTCATGGCCTCACCCCTGCTGAGTGCTT
TTAATGATCATGGGTCCAATATTAATGGTGTATGGTTGAAAATAAATCACACTTGTTTTATATTCTTCCAGCCGAAAATTTAAATCAACAGGAAATCCTAGTCATAAAAACATATGTAAT
AATAAGACAATTTAAACAAGAAGAGTTTGCATTATTTATATAATTTTTTTGAATTCCTGTCCATAAGATAAGAAGGAATCTATCTACTTGTAAAACTAACAATACAATGGACTGTTAACA
TAGCAAGTTGTTAATTAATATTATTTTTTCAGGGGTGTGATGCATCGATTTTGCTGGACAGCACTAACACCATAGACAGCGAGAAATTTGCTGCGCCAAATAACAATTCGGCGAGGGGTT
TTGAAGTTATTGATAACATGAAAGCTGCCGTTGAAAGGGCATGTCCAAGGGTTGTTTCCTGCGCTGATATTCTTACTATTGCGGCTGAACGATCCGTTGCTTTG
GTAATGAATTTCTATT
ACCAACTCCTCTTCCTGGTTAATATTTTACGCTTAGAAGTAAATTAATATGGGTATCAGAATAAGTTAAGAGAATAATGGTAAACCTTTGCAGTATTAATGTAATTTTTAACTATTTTTT
TCAATTAATAATAACCCCTATAAATTTAACGTGTTTTTATATTATTTTTTCAGTTAATTAAATAACCCGTGAGTTCAACTTTACCCTTAGAAGAATACATTAATTAAATAATTATTTACA
TAGAACAATGTGCAAGATCTGGGTCCACATGTTTAGCCTTTGCTAGTTTTTTTGACAAAATTGTCTATGTTTAGCCTTTACTAGCCTTTGCTAGTTATTGCATCTGCTATTCAACGACAA
AATTGTCCCACCATGTGGAAGTTGATTTAAGTGAAGGGATTCATCCTTGGACCCATCATTTTTAAATTCGGACGATGTGGTGGACTCCATTATTTAAAAGGGGTGATTTATTGACTATGG
TGCATTAGCTACACTGTATGGTACCAAAATTGCTACACGTATGGCAATATAGTGAATATTGACGGATAAATTGTTACCGACAGCGAGACACTTTTTACTGCGCTGGTGCATCGTAGTAGC
AAGGCCTTAGTTTTAAACTTAAAAGTTTTCTTCTTTTGTTATACGACAAAGTTTTGATTCAACGGCTAGCAAATTAAATAGTCCGCCCCAAACGCACATCTCTTAAGATTATTGCTGATT
TTGAGTGAATGGCTCTTGGTTACAGTCAGGGGGTCCGTCATGGGCAGTTCCATTGGGAAGAAGAGACAGCAGAACGGCAAACAGAGCTCTTGCAAATCAGAATCTTCCAGGACCATTTGA
TACTCTTGATGAGCTCAAATCTAGTTTTAGAAATGTTGGCCTCAATGACAAGCTTGATCTTGTTGCACTCTCCG
GTAATTATTAATTGCTTCTACATCCTTTTAGTTACTTGAGTAAAGT
TATGAGAGTAAACTTTTAGGAGTCAAAACTGCCTGCTACTAGTAACTCATACTCAAAAGTTAATTCACGAAATGAGTGTTGGTGCCTTAAATTTATATTTACTTAACTCCAAATTTAAAT
AATATCCCTAACAATAAAATTATCATTATTGTTCCTCGTATGTGAATTCAGTAAAAATAACAAAGATTTGGTCATGCATGTTTTTCAGGAGCACACACGTTCGGAAGGGCTCAGTGCCAA
TTTTTCAGGGGCAGATTATACGATTTTAACAACACTGGCAAGCCAGACCCAACCCTAGACGCAACCTTCTTACAACAACTGAGGAAACTATGCCCACAAGGTGGAAACGGCGGCGTTCTT
GCTAATTTTGATGTCACGACACCTGATGTTTTCGACAACAAATACTTCTCCAATCTTAGAGGCCGCAAAGGCCTTCTGCAGAGTGATCAAGAGTTATTTTCGACTCCTGGTGCCGATACC
GCTGCCATTGTCGAGGACTTTGGGAGGAACCAGAATGCTTTCTTTAAAAACTTTGTGACCTCAATGATAAGAATGGGAAATTTGAAACCACTGACAGGAAATCAAGGGGAGATTAGATTG
AACTGCAGGAGGGTCAATGGAAACAGTAATATTGCAACAAGATCATCATCATCAGAGGGTGATTTGGTCAGCTCTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTCGTTATCTTCTCGCAGCAGCTCTTCTTGTTGCTTTTGTGCTTGAGGGATCACCATCTCAAGCTCAACTTTCTCCATCTTTTTATTCTTCCACATGCCCTAATGTATTG
AACACTATCGAGGATGTGCTTAAGAAAGCTTTCTCGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTGAT
GGGTGTGATGCATCGATTTTGCTG
GACAGCACTAACACCATAGACAGCGAGAAATTTGCTGCGCCAAATAACAATTCGGCGAGGGGTTTTGAAGTTATTGATAACATGAAAGCTGCCGTTGAAAGGGCATGTCCAAGGGTTGTT
TCCTGCGCTGATATTCTTACTATTGCGGCTGAACGATCCGTTGCTTTG
TCAGGGGGTCCGTCATGGGCAGTTCCATTGGGAAGAAGAGACAGCAGAACGGCAAACAGAGCTCTTGCAAAT
CAGAATCTTCCAGGACCATTTGATACTCTTGATGAGCTCAAATCTAGTTTTAGAAATGTTGGCCTCAATGACAAGCTTGATCTTGTTGCACTCTCCG
GAGCACACACGTTCGGAAGGGCT
CAGTGCCAATTTTTCAGGGGCAGATTATACGATTTTAACAACACTGGCAAGCCAGACCCAACCCTAGACGCAACCTTCTTACAACAACTGAGGAAACTATGCCCACAAGGTGGAAACGGC
GGCGTTCTTGCTAATTTTGATGTCACGACACCTGATGTTTTCGACAACAAATACTTCTCCAATCTTAGAGGCCGCAAAGGCCTTCTGCAGAGTGATCAAGAGTTATTTTCGACTCCTGGT
GCCGATACCGCTGCCATTGTCGAGGACTTTGGGAGGAACCAGAATGCTTTCTTTAAAAACTTTGTGACCTCAATGATAAGAATGGGAAATTTGAAACCACTGACAGGAAATCAAGGGGAG
ATTAGATTGAACTGCAGGAGGGTCAATGGAAACAGTAATATTGCAACAAGATCATCATCATCAGAGGGTGATTTGGTCAGCTCTTTCTAA

Retrieve as FASTA