Entry information : CclPrx05 (clementine0.9_014469m)
Entry ID 8652
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx05 (clementine0.9_014469m)
Name (synonym) CclPrx05 (clementine0.9_014469m)
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx05
start..stop
S start..stop
CsPrx52 704 0 1..350 1..350
CsPrx61 686 0 1..350 1..350
CsPrx54 662 0 1..350 1..349
CclPrx68 661 0 1..350 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1105777..1105995 219 N° 2 1105193..1105384 192 N° 3 1104494..1104662 169 N° 4 1103495..1103967 473
complement(join(1103495..1103967,1104494..1104662,1105193..1105384,1105777..1105 995))


exon

Literature and cross-references CclPrx05 (clementine0.9_014469m)
Literature Forment,J. et al., Development of a citrus genome-wide EST collection and cDNA microarray as resources for genomic studies, Plant Mol. Biol. 57 (3), 375-391 (2005).
DNA ref. Phytozome 12:   scaffold_31 (1105995..1103495)
Protein sequence: CclPrx05 (clementine0.9_014469m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (324)
PWM (Da):   %s   37807.98 (35194.6)  
PI (pH):   %s   6.88 (6.88) Peptide Signal:   %s   cut: 27 range:27-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRFLLAAALVVAFVLEGSSPAQAQLSPSFYNSTCPNVTNIIREVLKNAFLSDIRIGASLIRLHFHDCFVNGCDASILLDNTTTIVSEKFAAPNNNSARGFEVVDDMKAAVERACPGVVSCADILTIAAEQSVALSGGPSWTNLLGRRDSRTANRTLANENLPGPNNSLERLKDRFRNVGLNDNFDLVALSGAHTFGRAQCRTFSDRLFNFNSTGNPDPTLNTTLLQQLRQLCPQGGNGSVLTNLDVTTPDVFDNKYFFNLQIHKGLLQSDQELFSTPGADTAAIVNNFGRNQTAFFENFVTSMIRMGNLKPLTGNQGEIRLNCRRVNGNSNIATRSSSSEGDLVSSF

Retrieve as FASTA  
Remarks Complete sequence from genomic. 2 ESTs. Assembly by PeroxiBase Team.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCTTCGTTTTCTCCTTGCAGCTGCTCTTGTAGTTGCATTTGTGCTTGAGGGATCATCACCAGCTCAAGCTCAACTTTCTCCCTCTTTTTATAATTCCACATGCCCTAATGTA
ACCAACATAATTCGGGAGGTGCTTAAGAATGCTTTCTTGTCCGATATTCGCATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTAAT
GTAATCAATCTCTACTCTTTG
ATTTTTCTTCTTTTTCAATTAATATTTTAAAATATGAATTAAGGTCCTCTTTTAATCTGAGTTTTGCATAGTTTTTTAAAAAATCTTGTGTAACATGTCCATTATTAGTAATATATGATT
GAAAATAACTACGTACACTTATATCCTTAACTTCTAACAGTCACAATTAAGCTCAGGAAAAGCTTACATCATGGGGGAAACCTGGTCTTACAAACTTATATAAGACAATTTGGATATATG
TATGTTTATCCAAAAAGAAAATGCACAAATATTCATTATTTTCTTAATAGTAAGATAAGAAGAATCTACCTAATTATTAAATTAACGATACAAGAGCAGTTGATCATAACAAGTTTTTAA
TGTTATTTCAGGGCTGTGATGCATCGATTTTGCTGGACAATACTACTACCATAGTAAGCGAGAAATTTGCTGCGCCAAATAATAATTCGGCGAGGGGTTTTGAAGTTGTTGATGACATGA
AAGCTGCCGTTGAAAGGGCCTGTCCAGGCGTTGTTTCATGTGCTGATATTCTTACTATTGCAGCTGAACAATCTGTTGCTCTG
GTATATATGAATTTCTATTAACAACTCATCTTGCTCT
ACTACATATTTTTAGCTTAAAAGTGATTAAATTACTATGGTATCAGAGAGTAAGTCTGACTTTACATTCGTGTTGGAATTTTCAGTCCCTGAGTACTTAACTAAATGAATCCACATGCTT
AGTTTTAGGCGGCAACAGTCCACCGACATTACCATGTTGACTTCGTGATAGTGCCTGGACAAACTTTACCGTATGAAAAGGGAAGGCTTCTCCTTCCCCCCACCCCCCCAAAAAAAAAGT
GATGAGATTCATGGAGGACACATCAGTTTTACGTGAAAATATCTTCTTTATGTGATACAGTCTGGTTGAACCGTTCACTCAAAATTGTAATGTCGGGAAACTGCTAATTTTGGGTGCAAA
AAGACCCATATAAATACTAGCCAAATAAAGTCGGAAAGAGTAATTGCATGTCTATTTCTGATTTTAGTTAAATTTGCTTATTATGCATCTCTCAAGTGATTCTTTTGACTAATGATCGTG
GTTTTGGTATCAGTCAGGGGGTCCTTCATGGACAAATCTATTGGGAAGGAGAGACAGCAGAACAGCCAACAGGACTCTTGCAAATGAAAATCTTCCAGGACCGAACAATAGTCTTGAGAG
GCTCAAAGATAGATTCAGAAATGTTGGCCTCAACGATAATTTTGATCTTGTTGCACTCTCCG
GTAATATTTGCTTATACACCCTTTGACTTGAGTACAAACAGACCTTGGAGTCTTTTGG
GATAAAGCAGTATTGGAGCCAGAATTAGAAATCTGGACGTGGAAAATTTTTTAATGCCAATACTGAGTCTTGAAATCTTAGAGATAGTTTAAATGTTGAATATCTTATTTAAAAAGAAAA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTAAGACGACCACCGACACAAAGCACATTCATACTCTACTGCACCTAGAAGG
CTTGACTGAATATCCTAATGATGGAAGAAACTGTGTTTTAAAGTTTGACATTGGTGACTAAGAATATGTTAAAACGTTTGACAAATTTACTCCCCTTAATCACATCATGAAATTTGAATT
GCTTCCCAAAAAGAAAAGTGAGAACCACCATAATGAAACTCCATTATTATCCTTAATTTGTATGAATTTGAGTAAAAATAACAAAGATTGGCTATGCATTTTTTTCAGGAGCTCACACAT
TTGGAAGGGCTCAGTGCCGAACTTTTAGCGATAGGTTATTCAATTTCAACAGCACTGGCAATCCAGACCCAACACTTAACACAACCCTCTTACAACAACTAAGGCAACTATGCCCACAAG
GTGGAAACGGCAGCGTTCTAACTAATCTTGATGTCACAACACCTGATGTGTTTGACAACAAATACTTCTTCAATCTTCAAATACACAAGGGCCTTCTGCAGAGTGATCAAGAGTTGTTTT
CGACTCCCGGGGCCGATACCGCTGCCATTGTCAATAACTTTGGCAGGAACCAGACTGCTTTCTTTGAAAACTTTGTGACTTCAATGATAAGAATGGGCAATTTGAAACCACTGACAGGAA
ATCAAGGGGAGATTAGATTGAACTGCAGGAGGGTCAACGGAAACAGCAATATCGCAACAAGATCATCATCATCGGAGGGTGATTTGGTCAGCTCTTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCTTCGTTTTCTCCTTGCAGCTGCTCTTGTAGTTGCATTTGTGCTTGAGGGATCATCACCAGCTCAAGCTCAACTTTCTCCCTCTTTTTATAATTCCACATGCCCTAATGTA
ACCAACATAATTCGGGAGGTGCTTAAGAATGCTTTCTTGTCCGATATTCGCATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTAAT
GGCTGTGATGCATCGATTTTG
CTGGACAATACTACTACCATAGTAAGCGAGAAATTTGCTGCGCCAAATAATAATTCGGCGAGGGGTTTTGAAGTTGTTGATGACATGAAAGCTGCCGTTGAAAGGGCCTGTCCAGGCGTT
GTTTCATGTGCTGATATTCTTACTATTGCAGCTGAACAATCTGTTGCTCTG
TCAGGGGGTCCTTCATGGACAAATCTATTGGGAAGGAGAGACAGCAGAACAGCCAACAGGACTCTTGCA
AATGAAAATCTTCCAGGACCGAACAATAGTCTTGAGAGGCTCAAAGATAGATTCAGAAATGTTGGCCTCAACGATAATTTTGATCTTGTTGCACTCTCCG
GAGCTCACACATTTGGAAGG
GCTCAGTGCCGAACTTTTAGCGATAGGTTATTCAATTTCAACAGCACTGGCAATCCAGACCCAACACTTAACACAACCCTCTTACAACAACTAAGGCAACTATGCCCACAAGGTGGAAAC
GGCAGCGTTCTAACTAATCTTGATGTCACAACACCTGATGTGTTTGACAACAAATACTTCTTCAATCTTCAAATACACAAGGGCCTTCTGCAGAGTGATCAAGAGTTGTTTTCGACTCCC
GGGGCCGATACCGCTGCCATTGTCAATAACTTTGGCAGGAACCAGACTGCTTTCTTTGAAAACTTTGTGACTTCAATGATAAGAATGGGCAATTTGAAACCACTGACAGGAAATCAAGGG
GAGATTAGATTGAACTGCAGGAGGGTCAACGGAAACAGCAATATCGCAACAAGATCATCATCATCGGAGGGTGATTTGGTCAGCTCTTTCTGA

Retrieve as FASTA