Entry information : CclPrx101 (clementine0.9_031343m)
Entry ID 8662
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx101 (clementine0.9_031343m)
Name (synonym) CclPrx101 (clementine0.9_031343m)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx101
start..stop
S start..stop
CsPrx35 667 0 1..326 1..326
RcPrx31 478 2e-171 1..326 1..335
PtPrx80 474 8e-170 1..326 1..337
PtPrx70 471 1e-168 1..326 1..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 445760..445972 213 N° 2 446458..446649 192 N° 3 446764..446929 166 N° 4 447347..447756 410
join(445760..445972,446458..446649,446764..446929,447347..447756)


exon

Literature and cross-references CclPrx101 (clementine0.9_031343m)
DNA ref. Phytozome 12:   scaffold_122 (445760..447756)
Protein sequence: CclPrx101 (clementine0.9_031343m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (301)
PWM (Da):   %s   35766.97 (32818.5) Transmb domain:   %s   i2-24o
PI (pH):   %s   6.86 (6.74) Peptide Signal:   %s   cut: 26 range:26-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGHIIFSSCTIPFFFILCLFPFVSSFPYSQFDGSCPYLPMIVRNGVWDAFRKDNRIAASLLRLHFHDCFIIGCDASILLDDTNDFKGEKNALPNRNSARGYEVIDSIKADVEKACPLTISCADILALAAREAVVLSGGPYWQVQLGRRDGLTASESAANAQLPSPFEPLDNIVAKFLAKGLDIKDVVVLSGAHTIGFAQCITFKNRLFNYKGSGQPDPALDSSALPDLKTICPNQDSSNSNLAPLDSPSAYRFDNVYYTNLVRRTGLLESDQALMGDPRTAALVKAYSMNPYLFYNDFATSMVKMSNIGILAGKDGQIRKSCRFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCACATTATTTTCTCAAGCTGCACTATTCCCTTCTTTTTCATCCTGTGTTTGTTTCCCTTTGTTTCCTCTTTTCCTTACAGCCAGTTTGATGGATCGTGCCCATACTTGCCAATG
ATTGTTAGGAATGGTGTTTGGGATGCTTTTAGGAAAGATAACAGAATAGCTGCATCCCTTCTCCGGTTGCACTTTCATGATTGTTTCATTATT
GTAACTATATACTCTCAAACTTATTAT
TTCTTCTTAGCATTATCCTCAAAACCAATTCGGAATTTTATAAGATAGCCTACAAAATAATATTTTTTTAGTTGCTAGGGTGTTTACTGATGATCAGGTTTGTGGAAAGACTGAAGAAAC
CTGAAGTGCTGCCAAAACTATGTTTTGTTAAGAGTGAAAGTGATGTTATTAGACATGCTATGTTTAGTACTTTTTAGATTTTGTTTTTCTTTCAGCCTGGGACCCATTAGTTTAGAAGAA
TTTCCTATTATACACATAACATGGAAATTTTGAGTCAGTTTTTATATTATCTGCAATGTTCATGATTTAGCACAAACAACATCTAATACTAAAAATGCTAAAGTGGTTCAATGAATGTTA
AAAGGAAGAAGTAAGATTAGAGTTATCGCAGTTTTGTTTTTGAATTTACTTCCAAGCAGTACAGTTTGAGTTCAAAGTTGTACTCTTTTGGTACACAGGGTTGTGATGCCTCAATTCTTC
TGGATGACACGAATGATTTCAAGGGGGAGAAAAATGCTCTGCCAAATCGCAATTCTGCTCGAGGATACGAAGTCATTGACAGTATAAAAGCAGATGTTGAAAAAGCTTGCCCATTAACTA
TTTCTTGTGCTGATATTTTGGCTCTTGCAGCCAGAGAGGCTGTTGTACTG
GTAATTAAACATATTCATAACTTAAAATCTATTTAACTGTTGTCTCAGGACTCGAGCCAAAATGAACTCT
TTCTTCAACTGATTTTTCCATCAAATCCTAATATTCTGGTTTAGTCAGGAGGGCCCTACTGGCAAGTTCAATTAGGCCGTAGAGATGGATTAACAGCAAGTGAGTCCGCAGCTAATGCAC
AGTTGCCATCACCTTTTGAGCCTCTGGATAACATTGTTGCCAAGTTCTTAGCAAAGGGCCTTGACATCAAGGATGTTGTAGTCCTCTCAG
GTTTTGATTCTTCTGCTTTCTTTTTCATTT
TAGTTGTTATTGTTTTAAAATCTCATGATTTCTAGATAAAAAGTCGATTCAAGAAAGAATTGTGCTTCATTGGCATTCCATCTGAAATGAGTGATCATTCCTTGCATTTGAAAGCATAAA
GGTTCTTACACTGGTCGAGCCATTTAAGAGGAAGCATGAGTAAGAGAACATAAATGATACTAAAGAGTCCTAATTTAAACTTAGCTTATTTATTTGAAAATCTTTTGTTTTGGCCCTCTC
AATTTACAGGATTTGTAGTTTCTTCATTTGGCCCCACTAAACCAAAATTCTATTTCACCCCCTGCATAATATTCATCTCAATGACTAGGTGATGTCTCAAATACAAATAATTAACATAAA
CCTTTGGCTACTTGGTTCTTTTTACAGGAGCACACACCATAGGTTTTGCTCAATGCATCACCTTCAAGAACAGACTCTTCAACTACAAAGGGTCTGGCCAGCCAGACCCTGCGCTCGATT
CTTCTGCACTGCCGGATTTGAAAACCATATGTCCAAACCAGGATTCGTCAAACAGCAACCTTGCTCCTCTTGACTCCCCAAGTGCATACAGATTTGACAATGTGTACTACACTAACCTCG
TTAGAAGGACAGGCCTTCTCGAATCCGATCAAGCATTAATGGGGGATCCTAGGACTGCTGCATTGGTTAAGGCTTATAGCATGAACCCATATCTGTTCTACAATGATTTTGCTACATCAA
TGGTGAAGATGAGTAATATTGGGATACTCGCTGGGAAAGATGGGCAAATCAGGAAGTCCTGTAGGTTTGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCACATTATTTTCTCAAGCTGCACTATTCCCTTCTTTTTCATCCTGTGTTTGTTTCCCTTTGTTTCCTCTTTTCCTTACAGCCAGTTTGATGGATCGTGCCCATACTTGCCAATG
ATTGTTAGGAATGGTGTTTGGGATGCTTTTAGGAAAGATAACAGAATAGCTGCATCCCTTCTCCGGTTGCACTTTCATGATTGTTTCATTATT
GGTTGTGATGCCTCAATTCTTCTGGAT
GACACGAATGATTTCAAGGGGGAGAAAAATGCTCTGCCAAATCGCAATTCTGCTCGAGGATACGAAGTCATTGACAGTATAAAAGCAGATGTTGAAAAAGCTTGCCCATTAACTATTTCT
TGTGCTGATATTTTGGCTCTTGCAGCCAGAGAGGCTGTTGTACTG
TCAGGAGGGCCCTACTGGCAAGTTCAATTAGGCCGTAGAGATGGATTAACAGCAAGTGAGTCCGCAGCTAATGCA
CAGTTGCCATCACCTTTTGAGCCTCTGGATAACATTGTTGCCAAGTTCTTAGCAAAGGGCCTTGACATCAAGGATGTTGTAGTCCTCTCAG
GAGCACACACCATAGGTTTTGCTCAATGC
ATCACCTTCAAGAACAGACTCTTCAACTACAAAGGGTCTGGCCAGCCAGACCCTGCGCTCGATTCTTCTGCACTGCCGGATTTGAAAACCATATGTCCAAACCAGGATTCGTCAAACAGC
AACCTTGCTCCTCTTGACTCCCCAAGTGCATACAGATTTGACAATGTGTACTACACTAACCTCGTTAGAAGGACAGGCCTTCTCGAATCCGATCAAGCATTAATGGGGGATCCTAGGACT
GCTGCATTGGTTAAGGCTTATAGCATGAACCCATATCTGTTCTACAATGATTTTGCTACATCAATGGTGAAGATGAGTAATATTGGGATACTCGCTGGGAAAGATGGGCAAATCAGGAAG
TCCTGTAGGTTTGTTAACTAA

Retrieve as FASTA