Entry information : CclPrx20 (clementine0.9_014549m)
Entry ID 8684
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx20 (clementine0.9_014549m)
Name (synonym) CclPrx20 (clementine0.9_014549m)
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx20
start..stop
S start..stop
CsPrx53 709 0 1..349 1..349
CppPrx03 669 0 12..349 1..337
CppPrx02 647 0 10..349 1..340
CsPrx62 637 0 16..349 16..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1101481..1101696 216 N° 2 1100624..1100815 192 N° 3 1099747..1099915 169 N° 4 1099020..1099492 473
complement(join(1099020..1099492,1099747..1099915,1100624..1100815,1101481..1101 696))


exon

Literature and cross-references CclPrx20 (clementine0.9_014549m)
DNA ref. Phytozome 12:   scaffold_31 (1101696..1099020)
Protein sequence: CclPrx20 (clementine0.9_014549m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (324)
PWM (Da):   %s   37938.27 (35232.8)  
PI (pH):   %s   8.39 (8.40) Peptide Signal:   %s   cut: 26 range:26-349
Sequence 391
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRYLLAAALVVAFVLEGSPSQAQLSPSFYSSTCPNVLNIIEDVLKKAFSSDIRIGASLIRLHFHDCFVDGCDASILLDSTNTIDSEKFAAPNNNSARGFEVIDNMKAAVEKACRRVVSCADILTIAAERSVALSGGPSWAVPLGRRDSRTANRALANQNLPGPSNSLDELKSSFRNVGLNDKFDLVALSGAHTFGRAQCKFFSDRLYDFNKTGKPDPTLDRTLLKQLRELCPQGGNGAVLANFDVKTPDAFDNKYFSNLRLRKGLLQSDQELFSTPGADTAAIVEDFGRNQTAFFKNFVISMIRMGNLKPLTGNQGEIRLNCRRVNGNNNIATRSSSSEGDLVSSF*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTCGTTATCTTCTTGCAGCAGCTCTTGTTGTTGCTTTTGTGCTTGAGGGATCACCATCTCAAGCTCAACTTTCTCCATCTTTTTATTCTTCCACATGCCCTAATGTATTG
AACATTATCGAGGATGTGCTTAAGAAAGCGTTCTCGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTGAT
GTAAGCAATCTCTGCTCTCTCATT
TTTCATCTTCTTTACTTTATCAAGCTCTCTGTCTATGTACTTACTGATATAACATAGTTTCAAGTATATCAATGAACAGTATCTTTATAATTTTTATGGCATTAAACAAAATATAGAGTT
TTCATTAAGAGTTTGAATATATCATTTTAATTTCAACAACTTCCAAAACCATTTTTATTTATCTTTTTTCTTTCTCTTTACAACAAATTTTTCCTCTCTAATTCGATGTACCGAGGACCA
TGTAATTCTCTGNNNNNNNNNNNNNNNNNNNNNGGGGTTTTCATGTACTAGAAATTTAAATCTAGCAAAGATTTGGTACAAAACAGGAAATAAAATCCACCTCATGGCCTCATCCCTGCT
GAGTTCTTTTAATGATCATGGGTCCAATATTAATGGTGTATGGTTGAAAAAAAATCACACTTGTTTTATATTCTTCCAACTGAGAAATTTAAATCAACTGGAAATCCTAGTCTTAAAAAC
ATATGTAATAATAAGACAATTTAAATAAGAAGAGTTTGCATTATTTATATAATTTTTTTGAATTCCTGTCCATAAGATAAGAAGGAATCTATGTACTTGAAAAAGTAATAATACAATGGA
CTGTTAACATAGCAAGTTGTTAATTAATATTATTTTTTCAGGGGTGTGATGCATCGATTTTGCTGGACAGCACTAACACCATAGACAGCGAGAAATTTGCTGCGCCAAATAATAATTCGG
CGAGGGGTTTTGAAGTTATTGATAACATGAAAGCTGCCGTTGAAAAGGCATGTCGAAGGGTTGTTTCCTGCGCTGATATTCTTACTATTGCGGCTGAACGATCCGTTGCTTTG
GTAATGA
ATTTCTATTACCAACTCCTCTTCCCAGTAAATATTTTACGCTTAGAAGTAAATTAATATGGGTATCAGAATAAGCGAACAGAATAATGATAAATCTTTGTAGTATTAATGTAGTGTTTAA
CNNNNNNNNNNNNNNNNNNNNNCCCATATAAATTTAACGTGTTTTTATATTATTTTTTTCAGTTAATTAAATATCCCGTAAGTTCAACTTTATCCTTAGAAGNNNNNNNNNNNNNNNNNN
NNNNNCACATAGAACAATGTGCAAGATCTGAGTCCACTGTTTAGCCTTTGCTAGTTATTGCATCTGCTATTCAACGACAAAATTGCCCCACCATGTGGAAATTGATTTAAGTGAAGGGAT
TCATCGTTGGACCGATCATTTTTAGATTCGGACGACGTGGTGGACTCCATTATTTAAAAGGGGTGACTTATTGACTATGGTGCATCAGCTACACTGTATGGTACCAAAATTGCTACAAGT
ATGTCAATATAGTGATTATCAACGGATAAATTGTTACCGACAGTGAGACACTTTTTACTGCGCTGGTGTATCGTAGCAAGGCCTTAGTTTTAAAATTAAAAGTTTTCTTCTTTTGTTATA
CGACAAAGTTTGATTCAACGGCTAGCAAATTAAATAGTCCGCCCCAAACACACATCTCTTAAGATTATTGCTGATTTTGAGTGAATGGCTTTTGGTTACAGTCAGGGGGTCCGTCATGGG
CAGTTCCATTGGGAAGAAGAGACAGCAGAACGGCAAACAGAGCTCTTGCAAATCAGAATCTTCCAGGACCATCTAATTCTCTTGATGAGCTCAAATCTAGTTTTAGAAATGTTGGCCTCA
ATGACAAGTTTGATCTTGTTGCACTCTCCG
GTAATTATTAATTGCTTCTACATCCTTTTAGTTACTTGAGTAAAGTTACGAGAGTAAACTTTTAGGAGTCAAAACTGCCTGCTAATAGTA
ACTCATACTCAAAAATTAATTTAAGAAATGAGTGTTGGTGCCTTAAATTTATATTTACTTAACTCAAAATTTAAATAATATCCCTAACAATAAAATTATCATTATTGTTCCTCGTATGTG
AATTCAGTAAAAATAACAAAGGTTTGGTCATGCATGTTTTTCAGGAGCTCACACGTTTGGAAGGGCTCAGTGCAAATTTTTCAGTGACAGATTATACGATTTCAACAAAACTGGCAAGCC
AGACCCAACACTGGACAGAACCCTCTTAAAGCAACTGAGGGAACTATGCCCACAGGGTGGAAACGGCGCCGTTCTTGCTAATTTTGATGTCAAAACACCTGATGCTTTCGACAACAAATA
CTTCTCCAATCTTAGACTCCGCAAAGGCCTTCTGCAGAGTGATCAAGAGTTGTTTTCGACTCCTGGTGCCGATACCGCTGCCATTGTCGAGGACTTTGGGAGGAACCAGACTGCTTTCTT
TAAAAACTTTGTGATCTCAATGATAAGAATGGGCAATTTGAAACCACTGACAGGAAATCAAGGGGAGATTAGATTGAACTGCAGGAGGGTCAATGGAAACAATAATATTGCAACAAGATC
ATCATCATCGGAGGGTGATTTGGTCAGCTCTTTCTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTCGTTATCTTCTTGCAGCAGCTCTTGTTGTTGCTTTTGTGCTTGAGGGATCACCATCTCAAGCTCAACTTTCTCCATCTTTTTATTCTTCCACATGCCCTAATGTATTG
AACATTATCGAGGATGTGCTTAAGAAAGCGTTCTCGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTGAT
GGGTGTGATGCATCGATTTTGCTG
GACAGCACTAACACCATAGACAGCGAGAAATTTGCTGCGCCAAATAATAATTCGGCGAGGGGTTTTGAAGTTATTGATAACATGAAAGCTGCCGTTGAAAAGGCATGTCGAAGGGTTGTT
TCCTGCGCTGATATTCTTACTATTGCGGCTGAACGATCCGTTGCTTTG
TCAGGGGGTCCGTCATGGGCAGTTCCATTGGGAAGAAGAGACAGCAGAACGGCAAACAGAGCTCTTGCAAAT
CAGAATCTTCCAGGACCATCTAATTCTCTTGATGAGCTCAAATCTAGTTTTAGAAATGTTGGCCTCAATGACAAGTTTGATCTTGTTGCACTCTCCG
GAGCTCACACGTTTGGAAGGGCT
CAGTGCAAATTTTTCAGTGACAGATTATACGATTTCAACAAAACTGGCAAGCCAGACCCAACACTGGACAGAACCCTCTTAAAGCAACTGAGGGAACTATGCCCACAGGGTGGAAACGGC
GCCGTTCTTGCTAATTTTGATGTCAAAACACCTGATGCTTTCGACAACAAATACTTCTCCAATCTTAGACTCCGCAAAGGCCTTCTGCAGAGTGATCAAGAGTTGTTTTCGACTCCTGGT
GCCGATACCGCTGCCATTGTCGAGGACTTTGGGAGGAACCAGACTGCTTTCTTTAAAAACTTTGTGATCTCAATGATAAGAATGGGCAATTTGAAACCACTGACAGGAAATCAAGGGGAG
ATTAGATTGAACTGCAGGAGGGTCAATGGAAACAATAATATTGCAACAAGATCATCATCATCGGAGGGTGATTTGGTCAGCTCTTTCTA

Retrieve as FASTA