Entry information : CclPrx23 (clementine0.9_014847m)
Entry ID 8687
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx23 (clementine0.9_014847m)
Name (synonym) CclPrx23 (clementine0.9_014847m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx23
start..stop
S start..stop
CsPrx25 706 0 1..343 1..343
PtPrx67 486 7e-174 1..342 1..350
NtPrx15-1A 466 4e-166 1..342 1..354
FvPrx01 464 2e-165 1..337 1..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1595963..1596202 240 N° 2 1597533..1597718 186 N° 3 1598366..1598971 606  
join(1595963..1596202,1597533..1597718,1598366..1598971)


exon

Literature and cross-references CclPrx23 (clementine0.9_014847m)
DNA ref. Phytozome 12:   scaffold_34 (1595963..1598971)
Protein sequence: CclPrx23 (clementine0.9_014847m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (317)
PWM (Da):   %s   37537.2 (34911.8)  
PI (pH):   %s   8.39 (8.56) Peptide Signal:   %s   cut: 27 range:27-343
Sequence 384
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATASASSFISLLLISSLLLASFTEAQKPPVAKGLSWTFYDQSCPKLESIVRKQIQNALKKDIGLAAGLIRIHFHDCFVQGCDGSVLLEGSTSEQNARPNLSLRKEALKFVDDLRARVHKECGRVVSCADILALAARDSVALSGGPNYDLPLGRRDSKTFATVVNLPSPFSNTTVILNDFREKTFNARETVALSGGHTVGLAHCPAFTNRLYPKQDPTLDKTFANNLKKTCPTSDSNNTTVFDIRSPNVFDNKYYVDLMNRQGLLTSDQDLYTDKRTRSIVTSFAVDQSLFFQEFANSMIKMSQLSVLTGKQGEIRAKCSVKNSNNLASVVEDVVEEAWSGII

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAACTGCTTCAGCTTCTTCTTTCATTTCTCTTCTTTTGATATCTTCTCTTTTGCTTGCTTCTTTCACTGAGGCACAAAAGCCCCCAGTAGCGAAAGGTCTCTCATGGACTTTTTATG
ACCAGAGCTGTCCCAAGCTTGAATCCATTGTCAGAAAACAGATCCAAAATGCCCTGAAAAAAGATATCGGCCTAGCTGCTGGCTTGATTCGCATCCATTTCCACGATTGCTTCGTTCAG
G
TAAAAGAAAAAGAAAATGATACCTCAATTAAGCTGGTGCATCACTTATTTCATGGTGTTAATGTGTTTTTAATAAATGCCCTTTTATTTAAAATGGTGATCATCATTAGTTGATCATTTC
TTGATTTGAAAAAAAAAAAAAAAAAGCCTAAGCACGTTTCTAACTCATGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATGTCTCCTCTAACGAAATTGTCTAAAAAA
GAACACAAGAATTTTCAAGCTAAAGGTCATATTTCCCCTTTGGACAATTATCTAGCTTGTCCCCATACGTATTGTAAAATATGACCTAAAAGGTCTATATTCTTAATTTTGTAGCAGTTG
AATACTTGAATCTAAGTTTTTAAGGGTAAAAAATATTTGTGTCTGATATAAAGTAAAACCAAAACAAATTTGAGGATACGCAACACATGAAAAAGTAGAAAATAATTAATAAATAGGAAA
AAAAAAAGGAAAACCATGTCGTTTGACTAAATTGATTCAAATTTCCCTAATATTTTAAAACAGATCTAAACTCTCTTAACTTCTTTTTTTTTTTTTTTTCACTTATCTTATCATTTTGAC
ATTGGAGGTTATTTGGTGTTGGGAATATCAGTACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACAAAATTATTAGAAAAACCAAGAGAAT
TGTCCTAGTTTTTCAATTAATTCTGAATTTTCCAGAATTAAATGCAACATAAACATATATATACTATTTTTTGGAGAATAATAATAAGAGGGTTGTGTGTGTATATATTGCATTAAATTA
TTCAATAAATTCGGAATTTTTTTTCAAAATTAACTAAAAAATTATAACAACTCCCCTACTGTTTCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGATATTCATATTCTCAATATCAAATAACTATTAAGCTGAAGGTACAGTGGTAAGATCAGTAAAATTTGACACTCAAGGGGATTATTGGATGTATTTTTAAAACAT
CAGGAAGATTTTGATTAGTTTAATTAAATGACAATGAGTTCAACGCCTTTTTCGTTACTACATATATTATAACATGAATATTATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTAG
ATTGCTCAAACCTAGAGACTAAAGGGGCCATAATTTTACAACTTTCTTTGGGTTTTTATAGGATGGTTGCCTTTTAAAAAGTCTTTTGTTTTGTTTTTGTTTTTTGACAAATTTAGTGAA
ATTTTGCAGGGATGTGATGGATCAGTGTTGCTAGAGGGATCAACTAGTGAGCAAAATGCACGTCCAAACCTAAGCTTAAGGAAGGAGGCTTTAAAATTTGTAGACGATCTTCGTGCTCGT
GTTCACAAGGAGTGTGGCAGAGTTGTTTCTTGTGCTGATATTCTTGCCCTTGCTGCTCGCGATTCTGTTGCCTTG
GTATTTATCTTCATTTCTTCTTTCACTCTTTTTGCTTTTCTAGTC
TCAAATCAGGACTTTAACTAACGAGCAAAACAACGTTATTGTTTGATGTGACCCCTTTTTTAAAAGAAGAAAAATTTAGTCATTCATTTATACATCCCATAATATCTAATAAAAATGTCA
AAGTTGTTAGATCCACCCAAGCCAGGAAAAAGGAGTCGGGTGGTCGGCCAATTAATTAATACCTATTTATGATTAAATGGTCATCTGCACTTATCCGATTATATAGATCCATATTTAATA
ACAATTANNNNNNNNNNNNNNNNNNNNNAATTATTACAACAAATAATAATTTTAACATCGAAGCCAAGGTTTAGCTCCGCTTAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGTTCACGATACATGTAGAAAAATGTTAAAAAGACTAAAAGAGGGACCAAAAAAATTGATTAAATACTTAATTATTTTCTGTTTTTTCTCTGCTATCN
NNNNNNNNNNNNNNNNNNNNNNNNCTTATCATTTTGTCCCTTTTTTTTTTTTCCAAATTTGTGCTCCAAATATTAGCGCTCATAGACATAACATACGATCAATTCATTGGTGTTGATGGC
AGTCTGGAGGGCCGAATTACGACCTACCATTGGGAAGGCGAGACAGCAAAACATTCGCAACAGTGGTAAATCTGCCATCACCGTTCAGCAACACCACCGTGATCCTCAACGATTTCCGAG
AAAAAACCTTCAACGCCAGGGAAACCGTGGCCCTCTCCGGCGGGCACACCGTTGGGCTAGCTCACTGCCCTGCATTCACCAATCGCCTCTATCCCAAACAAGACCCCACACTGGACAAAA
CATTCGCCAACAATCTCAAAAAGACATGCCCCACTTCGGATTCCAACAACACCACCGTCTTCGACATCCGGTCCCCGAACGTGTTCGACAACAAGTACTACGTTGACTTGATGAACCGAC
AGGGGTTGCTGACGTCGGACCAGGATCTTTACACGGACAAGAGAACGAGGAGCATTGTCACGAGCTTTGCTGTGGACCAGTCACTCTTCTTTCAAGAGTTTGCCAATTCGATGATAAAGA
TGTCGCAGTTGAGTGTGCTCACGGGGAAGCAAGGAGAGATTAGAGCCAAGTGCTCCGTCAAGAATTCCAATAATTTGGCTTCTGTTGTTGAGGATGTAGTTGAAGAGGCTTGGTCTGGGA
TTATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAACTGCTTCAGCTTCTTCTTTCATTTCTCTTCTTTTGATATCTTCTCTTTTGCTTGCTTCTTTCACTGAGGCACAAAAGCCCCCAGTAGCGAAAGGTCTCTCATGGACTTTTTATG
ACCAGAGCTGTCCCAAGCTTGAATCCATTGTCAGAAAACAGATCCAAAATGCCCTGAAAAAAGATATCGGCCTAGCTGCTGGCTTGATTCGCATCCATTTCCACGATTGCTTCGTTCAG
G
GATGTGATGGATCAGTGTTGCTAGAGGGATCAACTAGTGAGCAAAATGCACGTCCAAACCTAAGCTTAAGGAAGGAGGCTTTAAAATTTGTAGACGATCTTCGTGCTCGTGTTCACAAGG
AGTGTGGCAGAGTTGTTTCTTGTGCTGATATTCTTGCCCTTGCTGCTCGCGATTCTGTTGCCTTG
TCTGGAGGGCCGAATTACGACCTACCATTGGGAAGGCGAGACAGCAAAACATTCG
CAACAGTGGTAAATCTGCCATCACCGTTCAGCAACACCACCGTGATCCTCAACGATTTCCGAGAAAAAACCTTCAACGCCAGGGAAACCGTGGCCCTCTCCGGCGGGCACACCGTTGGGC
TAGCTCACTGCCCTGCATTCACCAATCGCCTCTATCCCAAACAAGACCCCACACTGGACAAAACATTCGCCAACAATCTCAAAAAGACATGCCCCACTTCGGATTCCAACAACACCACCG
TCTTCGACATCCGGTCCCCGAACGTGTTCGACAACAAGTACTACGTTGACTTGATGAACCGACAGGGGTTGCTGACGTCGGACCAGGATCTTTACACGGACAAGAGAACGAGGAGCATTG
TCACGAGCTTTGCTGTGGACCAGTCACTCTTCTTTCAAGAGTTTGCCAATTCGATGATAAAGATGTCGCAGTTGAGTGTGCTCACGGGGAAGCAAGGAGAGATTAGAGCCAAGTGCTCCG
TCAAGAATTCCAATAATTTGGCTTCTGTTGTTGAGGATGTAGTTGAAGAGGCTTGGTCTGGGATTATCTAA

Retrieve as FASTA