Entry information : CclPrx24 (clementine0.9_015052m)
Entry ID 8688
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-05 (Qiang Li)
Peroxidase information: CclPrx24 (clementine0.9_015052m)
Name (synonym) CclPrx24 (clementine0.9_015052m)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx24
start..stop
S start..stop
CsPrx24 640 0 1..329 1..338
GaPrx08 464 4e-166 9..329 9..327
GhPrx35 464 7e-166 9..329 9..327
CpapPrx39 455 2e-162 1..329 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 926331..926561 231 N° 2 926062..926244 183 N° 3 925805..925970 166 N° 4 925383..925687 305
N° 5 925251..925355 105  
complement(join(925251..925355,925383..925687,925805..925970,926062..926244,9263 31..926561))


exon

Literature and cross-references CclPrx24 (clementine0.9_015052m)
DNA ref. Phytozome 12:   scaffold_34 (926561..925251)
Protein sequence: CclPrx24 (clementine0.9_015052m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (306)
PWM (Da):   %s   35227.17 (32682.7)  
PI (pH):   %s   6.52 (5.49) Peptide Signal:   %s   cut: 24 range:24-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLNFKSPKALVFALIIIYNLLAARTVSSQGQLQVGFYSKTCPNAESIVSSVTQKTFERDPGSAAVLLRLQFHDCYVEGCDASILIDKGEEGERKASGNLGVGGFEIIAEAKAKLEGICPGVVSCADIVALAARDAVALVKGPFYEVPTGRRDGKVSSKSLADNLPEVDDSIQLLKSKFRQKGLSDRDLVLLSGGGHTIGLTACFFMQVRLYNFTPGGGSDPAINPEFLKQLKSKCPFQGDPNTRIPLDPVTDFIFDDQIFLNIKNGFAVIASDARLYDDENTKQILESYVSSAVSFKADFAKAMVKMGNLGVKTGSEGEIRRVCAAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCAATTTTAAAAGTCCAAAGGCCTTAGTTTTTGCTCTCATTATTATCTATAACCTTCTTGCTGCCAGAACTGTTTCATCACAAGGGCAACTCCAAGTTGGCTTCTACTCAAAAACA
TGCCCAAATGCCGAATCCATTGTCAGTTCTGTCACTCAGAAAACCTTTGAGCGTGACCCAGGAAGTGCCGCAGTTTTGCTAAGGCTTCAGTTCCATGACTGCTATGTCGAG
GTTTTTTTT
TTTTTTTTCTCTGTGGCACGTGCACAAACACACACACACAATTCCGAAGGATTTTTGCTGATATATTGCTTGTTCAGGGCTGTGACGCATCAATACTGATTGATAAAGGTGAAGAAGGAG
AAAGAAAAGCGTCGGGAAACTTAGGAGTTGGTGGTTTTGAGATCATAGCAGAAGCCAAAGCAAAATTGGAAGGTATTTGCCCTGGAGTTGTTTCTTGCGCGGATATTGTGGCTTTGGCTG
CCAGAGATGCTGTGGCTTTG
GTAAAATTTATTATACCGGGAGATTTCACTTATTTGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCGTTGGTATCTTTGACAGGTTAAAGGG
CCATTTTACGAAGTACCAACCGGCCGTAGGGATGGAAAGGTTTCAAGCAAATCCCTGGCTGATAATTTACCCGAAGTTGATGACTCAATTCAGCTTCTTAAATCTAAATTCAGGCAGAAG
GGTCTTTCTGATAGAGATCTTGTCCTTCTTAGTGGCG
GTATACCGATACACAATCTTTAAGAATCTTTTTGTTGGTTTAGATTGTCTACACACATTTAGAAGTCTATATAATTATGTTAT
AATTAAAGCTACTAAGTTGGTGTTTTATTTTCAGGTGGGCATACGATTGGACTCACTGCTTGCTTCTTCATGCAAGTCCGTCTCTACAATTTCACCCCTGGAGGTGGTTCGGATCCAGCG
ATAAATCCTGAATTCCTGAAGCAACTCAAATCCAAGTGCCCATTTCAGGGCGACCCTAATACCAGAATACCTCTGGATCCGGTGACTGATTTCATATTCGATGATCAGATTTTTTTGAAC
ATCAAAAATGGATTTGCTGTGATAGCGTCTGATGCTAGGCTTTATGATGATGAGAACACCAAGCAGATACTTGAATCCTATGTTAGTAGCGCTGTCGGG
AATTCTTCTAGCTCTGGGCCA
TTGCCATCTTTCAAGGCTGATTTTGCCAAAGCAATGGTGAAGATGGGCAATCTTGGCGTCAAAACTGGCTCAGAGGGGGAGATTAGACGAGTCTGCGCTGCTGTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCAATTTTAAAAGTCCAAAGGCCTTAGTTTTTGCTCTCATTATTATCTATAACCTTCTTGCTGCCAGAACTGTTTCATCACAAGGGCAACTCCAAGTTGGCTTCTACTCAAAAACA
TGCCCAAATGCCGAATCCATTGTCAGTTCTGTCACTCAGAAAACCTTTGAGCGTGACCCAGGAAGTGCCGCAGTTTTGCTAAGGCTTCAGTTCCATGACTGCTATGTCGAG
GGCTGTGAC
GCATCAATACTGATTGATAAAGGTGAAGAAGGAGAAAGAAAAGCGTCGGGAAACTTAGGAGTTGGTGGTTTTGAGATCATAGCAGAAGCCAAAGCAAAATTGGAAGGTATTTGCCCTGGA
GTTGTTTCTTGCGCGGATATTGTGGCTTTGGCTGCCAGAGATGCTGTGGCTTTG
GTTAAAGGGCCATTTTACGAAGTACCAACCGGCCGTAGGGATGGAAAGGTTTCAAGCAAATCCCTG
GCTGATAATTTACCCGAAGTTGATGACTCAATTCAGCTTCTTAAATCTAAATTCAGGCAGAAGGGTCTTTCTGATAGAGATCTTGTCCTTCTTAGTGGCG
GTGGGCATACGATTGGACTC
ACTGCTTGCTTCTTCATGCAAGTCCGTCTCTACAATTTCACCCCTGGAGGTGGTTCGGATCCAGCGATAAATCCTGAATTCCTGAAGCAACTCAAATCCAAGTGCCCATTTCAGGGCGAC
CCTAATACCAGAATACCTCTGGATCCGGTGACTGATTTCATATTCGATGATCAGATTTTTTTGAACATCAAAAATGGATTTGCTGTGATAGCGTCTGATGCTAGGCTTTATGATGATGAG
AACACCAAGCAGATACTTGAATCCTATGTTAGTAGCGCTGTCGGG
TCTTTCAAGGCTGATTTTGCCAAAGCAATGGTGAAGATGGGCAATCTTGGCGTCAAAACTGGCTCAGAGGGGGAG
ATTAGACGAGTCTGCGCTGCTGTTAATTGA

Retrieve as FASTA