Entry information : CclPrx30 (clementine0.9_015306m)
Entry ID 8690
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx30 (clementine0.9_015306m)
Name (synonym) CclPrx30 (clementine0.9_015306m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx30
start..stop
S start..stop
CsPrx59 669 0 1..333 1..333
PpePrx07 519 0 13..332 14..332
GhPrx22 515 0 24..333 26..333
RcPrx16 513 0 8..333 12..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4050774..4050992 219 N° 2 4051067..4051261 195 N° 3 4051343..4051508 166 N° 4 4051689..4052110 422
join(4050774..4050992,4051067..4051261,4051343..4051508,4051689..4052110)


exon

Literature and cross-references CclPrx30 (clementine0.9_015306m)
DNA ref. Phytozome 12:   scaffold_2 (4050774..4052110)
Protein sequence: CclPrx30 (clementine0.9_015306m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (307)
PWM (Da):   %s   35028.22 (32262.8)  
PI (pH):   %s   5.68 (5.68) Peptide Signal:   %s   cut: 27 range:27-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFYSLTSSIAAATIFITLLFSNSQAQLNSSFYATTCPNVTTIVRNALQQAMQSDIRIGASLIRLHFHDCFVNGCDGSVLLDRGGNITQSEKDGGPNTNSARGFGVVDNIKTAVENSCPGVVSCADILALAAESSVSLAGGPSWNVLLGRRDGLRANQSGANSSIPAPIDSLSNLTSKFSAVGLDTTDLVALSGAHTFGRAQCRIFSSRLYNFNGTGNPDPTVNGTYLTTLRRICPQNGNGSALANLDPTTADTFDNNYYTNLQNNQGLLQSDQELFSTNGPAAIVAIVNNFASNQTAFFQQFVQSMINMGNISPLTGSNGEIRADCKKVNGS

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCTATTCGCTCACTTCTTCAATAGCAGCAGCCACCATTTTCATAACATTGTTGTTCAGTAACTCACAGGCTCAACTGAACTCCTCATTTTATGCTACAACATGTCCGAATGTG
ACCACCATTGTGCGCAATGCTCTGCAGCAAGCCATGCAATCCGACATCAGAATCGGCGCCAGCCTCATTCGCCTCCATTTCCACGATTGCTTCGTTAAT
GTAATCAATCATGCTCGAATT
CATAACCTCCATTAATCAATTACAATAATAATTATAATCGTTCTTTGTTTCAGGGGTGTGACGGTTCGGTTTTGTTAGACAGAGGCGGAAACATAACACAGAGCGAGAAAGATGGCGGTC
CTAACACTAATTCGGCCAGAGGGTTTGGTGTTGTCGACAACATCAAGACTGCTGTCGAGAATTCTTGCCCCGGTGTTGTTTCTTGTGCTGACATTCTAGCTCTTGCTGCTGAGTCTTCTG
TCTCTTTG
GTAACTTAATTAGTTAATTAAATATGACTTTAATTTATATTAACCCTATAATTAAGAATAACTAATTCTGTTGATTTTCAGGCAGGAGGCCCTTCATGGAATGTACTATTGG
GAAGGAGGGACGGTTTAAGGGCAAATCAAAGCGGAGCAAATTCCTCTATTCCCGCTCCTATTGACAGCTTAAGCAACCTCACTTCCAAATTCTCTGCCGTTGGTCTAGACACCACCGATC
TTGTTGCTTTATCCG
GTAATCATAAATACACATAGTTGTTTTTAGGTGCGGACGCTTGCAACTTATAAAGTGCGGATTTGATCTACAACCAGTGTCCTATGCCGCAGTAGGAAAATCGGC
ACTTTATAAGCTAATTTAGGAACATTGTTGCAACTTCGGGAGCAGTATTGATTGTGTGTATGTGTAATTTTGCAGGGGCACATACTTTCGGACGTGCACAATGTCGAATATTCAGCAGCA
GGCTGTACAATTTCAATGGCACGGGCAACCCGGACCCAACGGTAAACGGAACGTATTTGACAACTCTGCGGCGAATTTGCCCACAAAATGGTAATGGCTCGGCGCTAGCGAATCTCGATC
CCACAACAGCAGATACTTTTGACAATAATTACTACACAAATCTTCAAAACAATCAAGGGCTTTTGCAATCAGACCAAGAGCTATTTTCAACAAATGGTCCTGCTGCTATTGTCGCCATTG
TGAACAATTTTGCTAGCAACCAAACAGCATTTTTCCAACAGTTCGTTCAGTCTATGATTAACATGGGCAATATTAGCCCATTAACGGGGAGCAATGGAGAAATTAGAGCAGATTGTAAGA
AAGTTAATGGAAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCTATTCGCTCACTTCTTCAATAGCAGCAGCCACCATTTTCATAACATTGTTGTTCAGTAACTCACAGGCTCAACTGAACTCCTCATTTTATGCTACAACATGTCCGAATGTG
ACCACCATTGTGCGCAATGCTCTGCAGCAAGCCATGCAATCCGACATCAGAATCGGCGCCAGCCTCATTCGCCTCCATTTCCACGATTGCTTCGTTAAT
GGGTGTGACGGTTCGGTTTTG
TTAGACAGAGGCGGAAACATAACACAGAGCGAGAAAGATGGCGGTCCTAACACTAATTCGGCCAGAGGGTTTGGTGTTGTCGACAACATCAAGACTGCTGTCGAGAATTCTTGCCCCGGT
GTTGTTTCTTGTGCTGACATTCTAGCTCTTGCTGCTGAGTCTTCTGTCTCTTTG
GCAGGAGGCCCTTCATGGAATGTACTATTGGGAAGGAGGGACGGTTTAAGGGCAAATCAAAGCGGA
GCAAATTCCTCTATTCCCGCTCCTATTGACAGCTTAAGCAACCTCACTTCCAAATTCTCTGCCGTTGGTCTAGACACCACCGATCTTGTTGCTTTATCCG
GGGCACATACTTTCGGACGT
GCACAATGTCGAATATTCAGCAGCAGGCTGTACAATTTCAATGGCACGGGCAACCCGGACCCAACGGTAAACGGAACGTATTTGACAACTCTGCGGCGAATTTGCCCACAAAATGGTAAT
GGCTCGGCGCTAGCGAATCTCGATCCCACAACAGCAGATACTTTTGACAATAATTACTACACAAATCTTCAAAACAATCAAGGGCTTTTGCAATCAGACCAAGAGCTATTTTCAACAAAT
GGTCCTGCTGCTATTGTCGCCATTGTGAACAATTTTGCTAGCAACCAAACAGCATTTTTCCAACAGTTCGTTCAGTCTATGATTAACATGGGCAATATTAGCCCATTAACGGGGAGCAAT
GGAGAAATTAGAGCAGATTGTAAGAAAGTTAATGGAAGCTAG

Retrieve as FASTA