Entry information : CclPrx32 (clementine0.9_015410m)
Entry ID 8692
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx32 (clementine0.9_015410m)
Name (synonym) CclPrx32 (clementine0.9_015410m)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx32
start..stop
S start..stop
CsPrx08 617 0 1..331 1..317
VvPrx04 530 0 15..331 3..321
NnPrx75 528 0 4..331 2..330
GhPrx26 526 0 24..331 21..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1613700..1613927 228 N° 2 1614039..1614233 195 N° 3 1614390..1614555 166 N° 4 1614866..1615272 407
join(1613700..1613927,1614039..1614233,1614390..1614555,1614866..1615272)


exon

Literature and cross-references CclPrx32 (clementine0.9_015410m)
DNA ref. Phytozome 12:   scaffold_23 (1613700..1615272)
Protein sequence: CclPrx32 (clementine0.9_015410m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (302)
PWM (Da):   %s   36216.18 (32897.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.14 (8.20) Peptide Signal:   %s   cut: 30 range:30-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTGRFNFDLIIALSLFLSLCLFPHTILAQLKQDYYAKTCPNVEKIVRTQVEKKFRQTFVTVPATIRLFFHDCFVQGCDASVIIQSTGNNTAEKDHPDNLSLAGDGFDTVVKAKQAVEQFCKNTVSCADILALATRDVIALSGGPSYSVELGRLDGLSSTASSVSGKLPQPTFNLNQLNSLFGANGLDQTDMIALSAGHTVGFSHCSKFANRIYNFSPQNPVDPTLNKTYATELQQMCPKNVDPRIAINMDPNTPKTFDNMYFKNLQQGKGLFTSDQVLYTDGRSKPAVDRWASSPADFQTAFITAITKLGRVNVKTGSDGNIRRDCSAFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCACTGGTCGATTCAATTTCGATCTTATAATCGCTCTGTCTCTTTTTCTAAGTTTGTGCCTGTTCCCCCACACAATATTGGCCCAACTCAAACAAGACTACTACGCCAAAACATGC
CCAAACGTAGAAAAGATTGTCAGAACTCAAGTGGAAAAGAAATTTCGGCAAACTTTTGTCACTGTTCCTGCCACCATCCGTCTCTTCTTCCATGATTGCTTCGTCCAG
GTAACAATAATT
CAGTTATATCTATTTAATTTAAATTAGTGCATTGATTATATAATGAATTAAAATTAAGATCACCCATCCTCACGACTCATGATATTGGTTCCATTACAGGGTTGTGATGCTTCGGTTATA
ATCCAATCAACTGGAAACAACACAGCGGAGAAAGATCACCCTGATAACCTGTCCTTAGCTGGAGATGGATTCGACACCGTTGTCAAAGCCAAACAAGCAGTTGAACAGTTTTGCAAGAAC
ACGGTCTCTTGTGCTGACATCCTCGCCTTGGCCACACGAGATGTCATTGCACTG
GTTGGTAAATCTATAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATAC
ATAGGATGGGAAAAGCATGGCTAGTGATTAATGTTGATGTTGGGTTACTAGCTAACTAATTAGTGNNNNNNNNNNNNNNNNNNNNNGCAGTCAGGTGGACCTTCGTATTCCGTCGAGTTA
GGAAGGCTCGATGGGCTTAGTTCGACGGCTTCAAGTGTAAGTGGGAAGCTGCCTCAGCCGACTTTCAATCTGAATCAGCTCAATTCACTGTTTGGTGCTAACGGCCTCGACCAAACTGAC
ATGATTGCCCTCTCAG
GTAACATTTGCCTTAGCCGCCTCAAAACTCAAAGTTAAAGAACCACGTTCCAATCATAAATTAATCAACACGATCTCTTCCAACTGGGCCCCACACCAGACGGA
TTAAATGGGCCACATCTCGTCTGACAGTGTGCTACTTTCGCTTCCGATTTGGATCATTGTTTAGTAACATCATCGTATTAGTTGGCAATATCAGTGTCACCGATGCCTTTCTTAGCACTA
AGCATCGTTACCAATGTTTTTTTTCCACGTACATGCATGTTGATCGTAATTTTGACCGTGATTGAATGATGATCTTTGTCTTGCAGCGGGACACACCGTTGGATTCTCTCATTGTAGCAA
GTTTGCAAATAGGATATACAATTTCAGCCCTCAGAACCCGGTGGACCCGACACTGAACAAGACATATGCGACCGAACTTCAACAAATGTGCCCCAAGAATGTGGACCCCAGGATCGCCAT
CAACATGGACCCCAACACACCCAAGACCTTTGATAATATGTACTTCAAGAATCTTCAACAAGGCAAGGGCCTCTTCACCTCCGACCAAGTCCTATATACCGACGGGAGGTCCAAGCCTGC
TGTTGATAGATGGGCCTCTAGCCCAGCTGATTTTCAAACGGCCTTTATCACCGCCATTACAAAATTGGGCAGGGTCAACGTCAAGACCGGAAGCGATGGGAATATTCGCCGGGATTGTTC
AGCCTTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCACTGGTCGATTCAATTTCGATCTTATAATCGCTCTGTCTCTTTTTCTAAGTTTGTGCCTGTTCCCCCACACAATATTGGCCCAACTCAAACAAGACTACTACGCCAAAACATGC
CCAAACGTAGAAAAGATTGTCAGAACTCAAGTGGAAAAGAAATTTCGGCAAACTTTTGTCACTGTTCCTGCCACCATCCGTCTCTTCTTCCATGATTGCTTCGTCCAG
GGTTGTGATGCT
TCGGTTATAATCCAATCAACTGGAAACAACACAGCGGAGAAAGATCACCCTGATAACCTGTCCTTAGCTGGAGATGGATTCGACACCGTTGTCAAAGCCAAACAAGCAGTTGAACAGTTT
TGCAAGAACACGGTCTCTTGTGCTGACATCCTCGCCTTGGCCACACGAGATGTCATTGCACTG
TCAGGTGGACCTTCGTATTCCGTCGAGTTAGGAAGGCTCGATGGGCTTAGTTCGACG
GCTTCAAGTGTAAGTGGGAAGCTGCCTCAGCCGACTTTCAATCTGAATCAGCTCAATTCACTGTTTGGTGCTAACGGCCTCGACCAAACTGACATGATTGCCCTCTCAG
CGGGACACACC
GTTGGATTCTCTCATTGTAGCAAGTTTGCAAATAGGATATACAATTTCAGCCCTCAGAACCCGGTGGACCCGACACTGAACAAGACATATGCGACCGAACTTCAACAAATGTGCCCCAAG
AATGTGGACCCCAGGATCGCCATCAACATGGACCCCAACACACCCAAGACCTTTGATAATATGTACTTCAAGAATCTTCAACAAGGCAAGGGCCTCTTCACCTCCGACCAAGTCCTATAT
ACCGACGGGAGGTCCAAGCCTGCTGTTGATAGATGGGCCTCTAGCCCAGCTGATTTTCAAACGGCCTTTATCACCGCCATTACAAAATTGGGCAGGGTCAACGTCAAGACCGGAAGCGAT
GGGAATATTCGCCGGGATTGTTCAGCCTTTAATTGA

Retrieve as FASTA