Entry information : CclPrx33 (clementine0.9_015453m)
Entry ID 8693
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx33 (clementine0.9_015453m)
Name (synonym) CclPrx33 (clementine0.9_015453m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx33
start..stop
S start..stop
CsPrx36 683 0 1..330 1..330
CsPrx04 538 0 1..329 1..327
PtPrx08 533 0 25..329 25..329
PtrePrx03 526 0 25..329 24..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 52257..52341 85 N° 2 52451..52599 149 N° 3 52706..52894 189 N° 4 53179..53344 166
N° 5 53674..54074 401  
join(52257..52341,52451..52599,52706..52894,53179..53344,53674..54074)


exon

Literature and cross-references CclPrx33 (clementine0.9_015453m)
DNA ref. Phytozome 12:   scaffold_101 (52257..54074)
Protein sequence: CclPrx33 (clementine0.9_015453m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (299)
PWM (Da):   %s   36830.65 (33213.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.84 (6.10) Peptide Signal:   %s   cut: 32 range:32-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATTKRLRFHLSPSFFFLLLPLLLQFHSGMSELQFNYYAQSCPKAEEIIKQQVVQLYYKHGNTAVSWVRNLFHDCAVSCDASLLLETVTGVASEQASERSFGMRNFKYVSTIKAALEAECPLKVSCADIVALSAREGIVMLGGPRIPIKTGRRDSRVSYLAEVEKFIPNHDDSIATALSVFNSIGIDDEGVVALYGAHSVGRVHCVNLVHRLYPTIDPTLDPVYAEYLKGRCPTPDPDPDAVVYARNDRETPMILDNNYYKNIINHKGLLIVDQQLASDPRTTPFVQKMAADNSYFHEQFSRAIALLSENNPLTGDQGEVRKDCRYVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACTACTAAGAGGCTACGGTTTCATCTTTCCCCAAGTTTCTTCTTTCTGTTATTACCGTTGCTCTTGCAGTTTCATTCTGGTAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAATACGCTGGTACGTAAAACAGTTTTCACTCTTGCATGGGTTACATTATTTTCTTGTTTCTTTGACTCAGGAATGAGTGAGCTGCAGTTTAATTACTACGCACAGAGTTGCCCAAA
AGCCGAAGAAATCATCAAGCAACAAGTCGTTCAGCTATACTACAAACATGGAAACACTGCAGTCTCCTGGGTCAGAAATCTTTTCCACGATTGCGCCGTCAAG
GTATTTTAATCCGGATT
TAGGTTCAATGTTGATCTAATAATAAGCTTTATATTAATTGATTATCTCTTTTCAGATTGTGATGATTAATAGTTAAATAATTTTGCAGTCATGCGATGCATCGCTCTTGCTGGAGACAG
TGACAGGTGTTGCATCGGAGCAGGCATCGGAAAGAAGCTTTGGAATGAGAAATTTCAAGTACGTGAGCACAATCAAAGCAGCTCTTGAGGCTGAATGCCCCTTGAAAGTTTCTTGCGCCG
ATATCGTGGCCCTTTCTGCACGAGAAGGCATTGTCATG
GTACGTCAATTAGTTCGTTAAAAGGTCAGTGATAGCCGTGGTTTGACGAAATGATGACGAAAGTTTATTGTTTTAAGATTTG
TAGAATCATTTTTTAACAAAAATGGGAAGAAATTAATGTGACCATTTCTAAAATTAAGAAATCTCTGCGATCATTTCAGCAAACCAGGACGGCGCTATTATCCTTTTATCCTCTTGAAAA
TTGAAAATGTTTCCGAAAATCAAATTTGATTATTGAAACGGATATGTATTATTTTGGTGGACGTGTTAATTATTACTAACAGTTGGGAGGCCCCCGTATCCCAATTAAAACTGGACGAAG
GGATAGCAGAGTGAGTTATTTGGCGGAGGTCGAAAAGTTCATCCCCAATCACGATGATAGCATAGCCACAGCCCTTTCCGTTTTTAATTCCATTGGCATCGATGATGAAGGAGTCGTTGC
TCTTTATG
GTATTTCCACTTCCTAACATCTTTTTTTTTTCTATTTTTCCCCCGATAATGACATAATTCGTGTTTAACTTTCTTGCAAGTTGTAATTAACTTTTCGTAGGGGTAATTTAGT
CTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTACTACGTTAGTCTTATAACATTTATTTTATAAACCAATATAGAAGTGATGTTTATATTAAATTCA
ATTATATATATCACACATCTAATAATTAGTCATATTAACTCTTATGTAATACGGATTTTCTCATAAAATATAACTTTGGTTTTGGTTTGGGGAGCAGGAGCTCATTCTGTAGGACGAGTC
CACTGCGTAAATCTCGTACACCGACTCTATCCCACCATTGATCCCACATTGGATCCCGTATACGCAGAGTATCTCAAAGGCCGGTGCCCTACGCCGGACCCCGATCCCGATGCAGTTGTA
TACGCAAGAAACGACAGAGAAACGCCAATGATTCTTGACAACAACTACTACAAGAACATAATAAACCACAAGGGATTGCTCATTGTTGATCAGCAATTGGCTTCTGATCCAAGAACAACT
CCATTTGTTCAGAAGATGGCCGCCGATAACAGCTACTTCCACGAACAATTTTCCAGGGCCATCGCCTTGTTGTCGGAGAATAATCCTCTTACCGGAGACCAAGGTGAAGTAAGAAAGGAT
TGCCGCTATGTGAATATA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACTACTAAGAGGCTACGGTTTCATCTTTCCCCAAGTTTCTTCTTTCTGTTATTACCGTTGCTCTTGCAGTTTCATTCTGGAATGAGTGAGCTGCAGTTTAATTACTACGCACAG
AGTTGCCCAAAAGCCGAAGAAATCATCAAGCAACAAGTCGTTCAGCTATACTACAAACATGGAAACACTGCAGTCTCCTGGGTCAGAAATCTTTTCCACGATTGCGCCGTCAAG
TCATGC
GATGCATCGCTCTTGCTGGAGACAGTGACAGGTGTTGCATCGGAGCAGGCATCGGAAAGAAGCTTTGGAATGAGAAATTTCAAGTACGTGAGCACAATCAAAGCAGCTCTTGAGGCTGAA
TGCCCCTTGAAAGTTTCTTGCGCCGATATCGTGGCCCTTTCTGCACGAGAAGGCATTGTCATG
TTGGGAGGCCCCCGTATCCCAATTAAAACTGGACGAAGGGATAGCAGAGTGAGTTAT
TTGGCGGAGGTCGAAAAGTTCATCCCCAATCACGATGATAGCATAGCCACAGCCCTTTCCGTTTTTAATTCCATTGGCATCGATGATGAAGGAGTCGTTGCTCTTTATG
GAGCTCATTCT
GTAGGACGAGTCCACTGCGTAAATCTCGTACACCGACTCTATCCCACCATTGATCCCACATTGGATCCCGTATACGCAGAGTATCTCAAAGGCCGGTGCCCTACGCCGGACCCCGATCCC
GATGCAGTTGTATACGCAAGAAACGACAGAGAAACGCCAATGATTCTTGACAACAACTACTACAAGAACATAATAAACCACAAGGGATTGCTCATTGTTGATCAGCAATTGGCTTCTGAT
CCAAGAACAACTCCATTTGTTCAGAAGATGGCCGCCGATAACAGCTACTTCCACGAACAATTTTCCAGGGCCATCGCCTTGTTGTCGGAGAATAATCCTCTTACCGGAGACCAAGGTGAA
GTAAGAAAGGATTGCCGCTATGTGAATATA

Retrieve as FASTA