Entry information : CclPrx42 (clementine0.9_015750m)
Entry ID 8699
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx42 (clementine0.9_015750m)
Name (synonym) CclPrx42 (clementine0.9_015750m)
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx42
start..stop
S start..stop
CsPrx39 615 0 18..315 1..298
RcPrx44 474 6e-170 34..316 12..293
PtPrx52 459 3e-164 43..316 27..300
PpePrx76 456 8e-163 38..314 16..292
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 854681..854971 291 N° 2 854371..854550 180 N° 3 854103..854268 166 N° 4 853699..854007 309
N° 5 853377..853408 32  
complement(join(853377..853408,853699..854007,854103..854268,854371..854550,8546 81..854971))


exon

Literature and cross-references CclPrx42 (clementine0.9_015750m)
DNA ref. Phytozome 12:   scaffold_63 (854971..853377)
Protein sequence: CclPrx42 (clementine0.9_015750m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325
PWM (Da):   %s   35140.45  
PI (pH):   %s   5.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVKTEAAFRLSTTERLLMSSNPGIGSFCKANGYVLFVFVLFRLAASPCCASLSFNFYAASCPSAEFMVANTVRSASSFDRTIPGKLLRLLFHDCFVEGCDASVLLQGNGTERSDPANASLGGFEVIDSAKRVLEIFCPGTVSCADIIALAARDSVEIAGGPAIQIPTGRRDGRASAAENVRANIVDTTFTMNEMIKAFSSKGLSMDDLVTLSGAHTIGSAHCNAFNDRFREDPKGKLTLIDTSLDSSYANELMRKCPANASSSVTVNNDPETSFVFDNQYYRNLLAHKGLFQSDSVLLHDERTRKQVENFANDQEKRLLAEVLIE

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTAAAAACTGAAGCGGCATTCAGACTCAGTACAACTGAAAGACTTCTCATGAGTTCAAATCCAGGAATTGGTTCATTTTGTAAAGCTAATGGCTACGTACTTTTTGTTTTTGTTCTG
TTCCGTCTTGCTGCTTCTCCTTGCTGTGCCAGCCTCTCTTTCAACTTCTATGCAGCTTCATGCCCCTCTGCTGAGTTCATGGTTGCAAACACGGTGAGATCAGCTTCCTCTTTTGATCGC
ACCATCCCCGGGAAGCTCCTCCGCCTGCTCTTCCATGACTGCTTCGTTGAG
GTAAGTGGTTCTTATCGAACAATTGCAATGTTGGAGTTCTCTTCCCACTAAATTTTAAAATCAAAGACT
GATGTGGATATGTAGTAGTCATTGGAAACAAAAACCTGAAAACTTTCACCAAAACCACCAGGGTTGTGATGCTTCTGTACTGCTACAAGGAAATGGGACAGAGCGAAGTGATCCAGCAAA
CGCATCTCTTGGAGGGTTTGAAGTTATTGATTCGGCGAAAAGAGTTCTTGAAATCTTCTGTCCTGGGACTGTTTCTTGTGCTGATATTATTGCTTTGGCCGCTAGAGATTCTGTTGAAAT
A
GTAAGATTTTCCCCTCTCATTAGTTACTGCTTTGTGCTGCTACTGCTCATTTTTATTTCATGTTGGTTGGGTTTCTTTCCATTCACAAAGACTTGAAAACAGGCTGGTGGCCCGGCAAT
TCAAATTCCTACAGGCAGGAGGGATGGGAGAGCATCAGCAGCTGAAAACGTTAGAGCCAACATTGTAGATACAACATTCACAATGAATGAGATGATAAAGGCCTTTTCCTCTAAAGGCTT
GTCCATGGATGACCTCGTTACTCTATCAG
GTATATCTCAGGACACGTTTGTAACTATTTTGCTTCTGCTTGATTTTAGAAAAATACAACATCTGAAAGTGTTTGATAAATTCCCACTTGA
GCAGGAGCTCACACAATTGGATCAGCTCATTGTAATGCATTCAATGATCGGTTTCGAGAGGACCCAAAGGGGAAACTGACATTGATAGACACGTCTCTGGACAGTTCTTATGCAAATGAG
CTAATGAGAAAGTGCCCAGCAAATGCAAGCTCATCTGTAACCGTTAACAATGATCCTGAAACATCATTTGTGTTCGATAATCAGTACTACCGCAACCTCTTAGCACACAAAGGGCTGTTT
CAATCAGATTCTGTTCTTTTACACGATGAAAGAACAAGGAAGCAAGTGGAGAATTTTGCAAATGATCAAGAAA
GTTTCTTCAGTAACTGGGGTCTGTCATTTTTGAAGGTTACTAGCATT
GGAGTGAAAACTGAAGATGAAGGGGAAATTCGACAAACTTGTTCAATGACTAATGGGTGAAGAATTATCAAGATCCAAAGCCTACACCAAATTGCTAGTCTAATAATTGCCTAAAACTTT
GGACCAATTTTCACGTACATATGTAAAGACCTTATAATTTGTTTGATATTTGTTGGTAATGGTTGAAGTTTTTGCTGTGGTTTCCTTTTTATTCATTAGGTCTTTTTTTTTTTTTTTACG
CAGAAAGATTGTTAGCAGAAGTTTTGATAGAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTAAAAACTGAAGCGGCATTCAGACTCAGTACAACTGAAAGACTTCTCATGAGTTCAAATCCAGGAATTGGTTCATTTTGTAAAGCTAATGGCTACGTACTTTTTGTTTTTGTTCTG
TTCCGTCTTGCTGCTTCTCCTTGCTGTGCCAGCCTCTCTTTCAACTTCTATGCAGCTTCATGCCCCTCTGCTGAGTTCATGGTTGCAAACACGGTGAGATCAGCTTCCTCTTTTGATCGC
ACCATCCCCGGGAAGCTCCTCCGCCTGCTCTTCCATGACTGCTTCGTTGAG
GGTTGTGATGCTTCTGTACTGCTACAAGGAAATGGGACAGAGCGAAGTGATCCAGCAAACGCATCTCTT
GGAGGGTTTGAAGTTATTGATTCGGCGAAAAGAGTTCTTGAAATCTTCTGTCCTGGGACTGTTTCTTGTGCTGATATTATTGCTTTGGCCGCTAGAGATTCTGTTGAAATA
GCTGGTGGC
CCGGCAATTCAAATTCCTACAGGCAGGAGGGATGGGAGAGCATCAGCAGCTGAAAACGTTAGAGCCAACATTGTAGATACAACATTCACAATGAATGAGATGATAAAGGCCTTTTCCTCT
AAAGGCTTGTCCATGGATGACCTCGTTACTCTATCAG
GAGCTCACACAATTGGATCAGCTCATTGTAATGCATTCAATGATCGGTTTCGAGAGGACCCAAAGGGGAAACTGACATTGATA
GACACGTCTCTGGACAGTTCTTATGCAAATGAGCTAATGAGAAAGTGCCCAGCAAATGCAAGCTCATCTGTAACCGTTAACAATGATCCTGAAACATCATTTGTGTTCGATAATCAGTAC
TACCGCAACCTCTTAGCACACAAAGGGCTGTTTCAATCAGATTCTGTTCTTTTACACGATGAAAGAACAAGGAAGCAAGTGGAGAATTTTGCAAATGATCAAGAAA
AAAGATTGTTAGCA
GAAGTTTTGATAGAATGA

Retrieve as FASTA