Entry information : CclPrx53 (clementine0.9_016390m)
Entry ID 8709
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx53 (clementine0.9_016390m)
Name (synonym) CclPrx53 (clementine0.9_016390m)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx53
start..stop
S start..stop
CppPrx09 644 0 1..312 1..312
CsPrx11 642 0 1..312 1..312
MePrx02 516 0 5..312 6..316
GhPrx23 513 0 1..312 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3002210..3002413 204 N° 2 3001913..3002101 189 N° 3 3001654..3001816 163 N° 4 3001180..3001562 383
complement(join(3001180..3001562,3001654..3001816,3001913..3002101,3002210..3002 413))


exon

Literature and cross-references CclPrx53 (clementine0.9_016390m)
DNA ref. Phytozome 12:   scaffold_25 (3002413..3001180)
Protein sequence: CclPrx53 (clementine0.9_016390m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (290)
PWM (Da):   %s   33373.76 (31076.6)  
PI (pH):   %s   8.57 (8.40) Peptide Signal:   %s   cut: 23 range:23-312
Sequence 353
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFRVAFLTSLLILSMSSSGNALSLNYYEKTCPDAEWIIAAAVKAAAAKDKTVPAALLRMHFHDCFIRGCDASVLLNSKGSNKAEKDGPPNVSLHAFYVIDNAKKQVEALCPGVVSCADILALAARDAVVLSGGPTWDVPKGRKDGRTSKASETVQLPAPTFNISQLQQSFSQRGLSMEDLAALSGGHTLGFAHCSSFQSRINMNNADPTINPSFAESLRNICPIHNQAKNAGANMDASSATFDNTYYKLILQGKSLFASDQALLSHPETKNLVSKFASSHQSFNEAFVKSMIKMSSINGGQEVRKDCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTTCGAGTTGCATTCTTGACCTCACTCCTCATACTTTCAATGTCTTCATCAGGAAATGCACTGAGTTTGAATTACTATGAGAAAACATGCCCTGATGCTGAGTGGATCATTGCG
GCTGCTGTCAAGGCTGCAGCTGCAAAAGATAAAACTGTCCCTGCAGCATTACTTCGGATGCATTTTCACGACTGTTTTATTAGG
GTATTAAGTTTCCTATTGATCTCACTCGTTAAAATT
GATTTTTTATTTTTTTTTTGACGATTCAAAGTTCATTTTGGTCTAAATCGCTTGCATTTCTTTTCTGTTAAGGGATGTGATGCATCAGTCCTGTTAAATTCAAAGGGGAGCAACAAGGCA
GAAAAGGATGGACCTCCTAATGTTTCTTTGCATGCATTCTATGTCATTGATAACGCAAAGAAACAAGTAGAAGCATTGTGCCCCGGTGTTGTCTCGTGTGCTGATATTTTGGCATTGGCC
GCCAGAGATGCTGTTGTCCTC
GTAAGATACTGCAACTAATATACTTTCTATTAACCAATTAATTTTTCCCCTTAAAATTGATCATCTTTGGATTGCTTATTTGATTTAATCTCACAGTCT
GGAGGTCCAACTTGGGACGTGCCTAAAGGAAGAAAAGATGGAAGAACATCCAAGGCTAGTGAAACAGTACAATTGCCCGCTCCGACCTTCAACATTTCTCAATTACAGCAGAGTTTCTCC
CAGCGAGGTCTATCAATGGAGGACCTAGCAGCTCTTTCAG
GTAAACATGCCCCACCTGCCACGGTCATCCATATAGCAAATTGCATTTATGAGCAGACAATGACAATGTTTTGGTTATGA
CTCTTTTGTAGGAGGGCATACTCTAGGATTTGCTCACTGTTCCTCCTTCCAAAGCAGAATAAACATGAACAATGCCGACCCTACAATAAATCCTTCATTTGCAGAGAGCTTGAGGAATAT
TTGTCCAATCCACAACCAGGCAAAGAATGCTGGTGCTAACATGGATGCTTCTTCAGCAACTTTTGATAATACATACTACAAGCTTATCCTGCAGGGAAAGAGCTTGTTTGCTTCAGACCA
AGCTCTGCTCAGTCACCCAGAGACCAAAAATTTAGTTTCTAAATTTGCCAGCTCACACCAATCTTTCAATGAAGCTTTTGTGAAGTCTATGATCAAAATGAGTAGCATCAATGGAGGACA
GGAGGTCCGGAAAGATTGTAGGGTGGTAAACTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTTCGAGTTGCATTCTTGACCTCACTCCTCATACTTTCAATGTCTTCATCAGGAAATGCACTGAGTTTGAATTACTATGAGAAAACATGCCCTGATGCTGAGTGGATCATTGCG
GCTGCTGTCAAGGCTGCAGCTGCAAAAGATAAAACTGTCCCTGCAGCATTACTTCGGATGCATTTTCACGACTGTTTTATTAGG
GGATGTGATGCATCAGTCCTGTTAAATTCAAAGGGG
AGCAACAAGGCAGAAAAGGATGGACCTCCTAATGTTTCTTTGCATGCATTCTATGTCATTGATAACGCAAAGAAACAAGTAGAAGCATTGTGCCCCGGTGTTGTCTCGTGTGCTGATATT
TTGGCATTGGCCGCCAGAGATGCTGTTGTCCTC
TCTGGAGGTCCAACTTGGGACGTGCCTAAAGGAAGAAAAGATGGAAGAACATCCAAGGCTAGTGAAACAGTACAATTGCCCGCTCCG
ACCTTCAACATTTCTCAATTACAGCAGAGTTTCTCCCAGCGAGGTCTATCAATGGAGGACCTAGCAGCTCTTTCAG
GAGGGCATACTCTAGGATTTGCTCACTGTTCCTCCTTCCAAAGC
AGAATAAACATGAACAATGCCGACCCTACAATAAATCCTTCATTTGCAGAGAGCTTGAGGAATATTTGTCCAATCCACAACCAGGCAAAGAATGCTGGTGCTAACATGGATGCTTCTTCA
GCAACTTTTGATAATACATACTACAAGCTTATCCTGCAGGGAAAGAGCTTGTTTGCTTCAGACCAAGCTCTGCTCAGTCACCCAGAGACCAAAAATTTAGTTTCTAAATTTGCCAGCTCA
CACCAATCTTTCAATGAAGCTTTTGTGAAGTCTATGATCAAAATGAGTAGCATCAATGGAGGACAGGAGGTCCGGAAAGATTGTAGGGTGGTAAACTA

Retrieve as FASTA