Entry information : CclPrx59 (clementine0.9_018553m)
Entry ID 8710
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx59 (clementine0.9_018553m)
Name (synonym) CclPrx59 (clementine0.9_018553m)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx59
start..stop
S start..stop
CsPrx09 642 0 20..329 1..310
EgrPrx124 520 0 8..329 4..325
NtPrx31-1A 514 0 16..329 13..327
LePrx69 504 0 16..329 20..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 683229..683453 225 N° 2 682745..682936 192 N° 3 682488..682650 163 N° 4 681967..682376 410
complement(join(681967..682376,682488..682650,682745..682936,683229..683453))


exon

Literature and cross-references CclPrx59 (clementine0.9_018553m)
DNA ref. Phytozome 12:   scaffold_25 (683453..681967)
Protein sequence: CclPrx59 (clementine0.9_018553m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (301)
PWM (Da):   %s   35946.9 (32748.4)  
PI (pH):   %s   7.26 (6.74) Peptide Signal:   %s   cut: 29 range:29-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEQQRQSSSRLSFLHLSCVMFLSTLVSCQLDYKYYDDTCPSLTRIVRYGVWSAISNETRMAASLLRLHFHDCFVKGCDGSVLLDDTSTTKGEKNAFPNRNSARGFEVIDAIKANLEKACPATVSCTDILTLVAREAVFLGGGPFWAVPLGRRDGLTASESEANNLPSPFEPLQNITAKFTARGLDLKDVVVLSGGHTIGFAQCLSFKNRLFDFSGSGKPDPTLDASLLQSLQSTCPSQADSDTKLVALDSVTTNKFDNIYFQNLVNKSGLLQSDQALMGDNRTAAMVQYYSKYPYFFSKDFGASMVKMANIGVLTGQDGEIRKNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (A long part of exon is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCAGCAGCGGCAGAGCTCTAGCAGACTTTCCTTTCTTCACTTGTCCTGTGTCATGTTCCTGAGTACTCTAGTGTCCTGTCAACTTGATTATAAATATTATGACGACACTTGCCCC
AGCTTGACAAGAATAGTTCGATATGGGGTTTGGTCCGCCATATCAAATGAAACAAGGATGGCAGCCTCTCTCTTGCGGCTTCACTTCCATGATTGTTTTGTCAAA
GTAATTTTGGTTACC
CTTTTCAAGTTTAGCCATTTCAGTTATAAGATCTTTTATGTTAATTTTGTTATGATTATGTTCAAGCTAACTTAGGGGAAAACATTAAGAAAGTAGACAATAAGAGATGCATGGTTATGT
ATTCTCATGAACTTCAGAGACAAGAAAGTTAAAGCTACTTATAAACTCCTGTGCTACTTTATCAATCTTATAATAATGTTGACAACCCATCATTGTAGACTTTTCTGGTCTGCGGAAGCT
TACTGCAGAAACCATTCTTTTTCACTTCTTGATGCAGGGATGCGACGGTTCTGTACTGCTTGATGATACCAGCACAACTAAAGGGGAGAAAAATGCGTTTCCTAACCGAAACTCAGCCAG
AGGTTTTGAGGTCATTGACGCTATTAAGGCTAATTTGGAGAAAGCTTGTCCAGCCACTGTTTCTTGTACTGATATATTAACTCTTGTGGCAAGAGAGGCTGTATTTCTA
GTACGAAAATC
CTCCCCCGTAACTACTCTTTCACATTGTTTTGGCATTATTGTTCCTGAATTATAATTATCATTTTCTTAATATATTTTCTCAGGGTGGTGGTCCGTTTTGGGCTGTACCCTTAGGTCGCC
GAGATGGCTTAACAGCAAGTGAGAGCGAAGCTAACAATCTGCCATCTCCTTTCGAACCTTTACAGAACATCACCGCAAAGTTCACTGCGAGGGGTCTTGATCTGAAGGATGTTGTTGTGC
TCTCAG
GTTTGCCTTCCCATATCACAGTCACTTCTCCAAATCATGACATTCCATATCTGAAATATAAGGAGCAGTAACCTTTTCCTTTATAACACAGTCGTGTGAAATGAACGACAGGTG
GGCACACAATTGGCTTTGCTCAATGCTTGTCATTCAAGAATAGGCTATTCGACTTCAGTGGCTCTGGAAAGCCTGATCCAACACTTGATGCTTCACTACTACAAAGTCTGCAAAGCACGT
GTCCCAGTCAAGCTGATTCTGATACAAAACTGGTTGCTCTGGATTCTGTCACTACAAACAAGTTCGACAATATTTACTTCCAAAATCTGGTGAACAAATCTGGGTTACTCCAGTCAGATC
AAGCTCTCATGGGAGACAACAGAACTGCTGCAATGGTTCAATATTACAGCAAGTACCCTTACTTTTTCTCCAAAGATTTTGGTGCATCAATGGTGAAGATGGCCAACATAGGTGTATTAA
CTGGGCAAGATGGGGAGATAAGGAAGAATTGTCGCGTCGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCAGCAGCGGCAGAGCTCTAGCAGACTTTCCTTTCTTCACTTGTCCTGTGTCATGTTCCTGAGTACTCTAGTGTCCTGTCAACTTGATTATAAATATTATGACGACACTTGCCCC
AGCTTGACAAGAATAGTTCGATATGGGGTTTGGTCCGCCATATCAAATGAAACAAGGATGGCAGCCTCTCTCTTGCGGCTTCACTTCCATGATTGTTTTGTCAAA
GGATGCGACGGTTCT
GTACTGCTTGATGATACCAGCACAACTAAAGGGGAGAAAAATGCGTTTCCTAACCGAAACTCAGCCAGAGGTTTTGAGGTCATTGACGCTATTAAGGCTAATTTGGAGAAAGCTTGTCCA
GCCACTGTTTCTTGTACTGATATATTAACTCTTGTGGCAAGAGAGGCTGTATTTCTA
GGTGGTGGTCCGTTTTGGGCTGTACCCTTAGGTCGCCGAGATGGCTTAACAGCAAGTGAGAGC
GAAGCTAACAATCTGCCATCTCCTTTCGAACCTTTACAGAACATCACCGCAAAGTTCACTGCGAGGGGTCTTGATCTGAAGGATGTTGTTGTGCTCTCAG
GTGGGCACACAATTGGCTTT
GCTCAATGCTTGTCATTCAAGAATAGGCTATTCGACTTCAGTGGCTCTGGAAAGCCTGATCCAACACTTGATGCTTCACTACTACAAAGTCTGCAAAGCACGTGTCCCAGTCAAGCTGAT
TCTGATACAAAACTGGTTGCTCTGGATTCTGTCACTACAAACAAGTTCGACAATATTTACTTCCAAAATCTGGTGAACAAATCTGGGTTACTCCAGTCAGATCAAGCTCTCATGGGAGAC
AACAGAACTGCTGCAATGGTTCAATATTACAGCAAGTACCCTTACTTTTTCTCCAAAGATTTTGGTGCATCAATGGTGAAGATGGCCAACATAGGTGTATTAACTGGGCAAGATGGGGAG
ATAAGGAAGAATTGTCGCGTCGTGAACTAG

Retrieve as FASTA