Entry information : CclPrx93 (clementine0.9_029696m)
Entry ID 8723
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx93 (clementine0.9_029696m)
Name (synonym) CclPrx93 (clementine0.9_029696m)
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx93
start..stop
S start..stop
CsPrx41 700 0 1..338 1..338
PtPrx92 545 0 1..338 1..341
PtPrx95 534 0 1..338 1..340
CppPrx07 530 0 22..281 1..260
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3734493..3734729 237 N° 2 3734843..3735034 192 N° 3 3735315..3735480 166 N° 4 3735637..3736058 422
join(3734493..3734729,3734843..3735034,3735315..3735480,3735637..3736058)


exon

Literature and cross-references CclPrx93 (clementine0.9_029696m)
DNA ref. Phytozome 12:   scaffold_10 (3734493..3736058)
Protein sequence: CclPrx93 (clementine0.9_029696m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (309)
PWM (Da):   %s   37479.87 (34131.0)  
PI (pH):   %s   6.23 (5.19) Peptide Signal:   %s   cut: 30 range:30-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANSLHHPRLPILQFLLLVFSSFIPRLHASEPYLTLDYYAKTCPTAFEIVRKEMECAVLSDPRNAALIVRLHFHDCFVQGCDGSVLLDDTIDLQGEKKASINRNALKGFRIIDRIKNKIESDCPGIVSCADILTIAARDAIILVGGPYWDVPVGRKDSKTASYALADSNLPSPDEGLLSIISKFHYQGLSVTDMVALSGAHTIGMARCVNYRKRIYGDYRVTSGINPLSETHLSVLKSICPPIGSDNNETAMDYETPNLFDNSFYQILLQGEGLLNSDQEMYSSIFGIQTKELVNKYAHDALGFFQQFSDSMVKMGNITNPESFVNGEVRKNCRFVNT

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Long 5' end has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAATTCTCTTCATCATCCTAGGCTTCCAATTTTGCAATTTTTGCTTTTGGTTTTCTCAAGTTTTATCCCCCGGTTGCATGCAAGTGAACCTTATTTGACGTTGGATTACTATGCA
AAGACTTGCCCGACTGCGTTCGAGATTGTGAGAAAAGAAATGGAATGTGCTGTGCTTTCGGATCCGCGCAACGCCGCCCTTATAGTCCGACTACACTTCCATGATTGCTTTGTACAG
GTT
CACATATTTAGCTGCACTGTTTGCTTAAACTAATTACGTTAAACTGTGGGTTAAGCACTCATATTAGCTAGCAGTATATTGTTGAAACTTATACAGATATCTGCATGCAGGGATGTGACG
GGTCAGTTTTACTAGACGATACTATCGACTTACAAGGAGAAAAAAAGGCTTCTATTAACAGAAACGCCCTGAAAGGTTTTAGGATTATAGACAGGATCAAGAACAAGATCGAATCCGATT
GCCCTGGAATCGTCTCTTGTGCAGATATTCTCACCATTGCTGCTAGAGACGCAATCATTCTG
GTAATATATATACAATGAAAATTTACTCTTATGCGTTATCTTTCTCTTCTCAGATTTA
GATTTAGTGCTAATCTTTTTACGAGGATGTAATTGCTGGTCATTAGATGAAGTTATATATTTAATATATCTGTATACTTTTATAAGTTCAAACATGGTATAAAATTTTTAACAGATCAGA
ACAGGTCATAAAAGCACTGAATCCAAACTCAAAGTCCTTTGTGGAACACAAAAATAATATATACGTTCATCTGTTTTGAATTGATGGAATTGTAATGTCCAGGTTGGTGGACCTTATTGG
GATGTTCCAGTGGGAAGAAAGGACTCTAAAACTGCAAGCTATGCATTAGCAGACTCGAATCTGCCCAGTCCAGATGAGGGCCTCCTCTCTATTATTTCTAAGTTTCATTATCAAGGCCTA
TCTGTCACCGATATGGTGGCTCTTTCAG
GTAAGCTACATATGATTCTCACAATAATGGGACCATTCAATGAAATCATGTCACGCGTATTTCATGTATACATTGTAATAAGAACTTATTGG
ATGAGCGCAGCATGACTTTTTTGGTTGAAACACTGCATGATTAATTTCTCAAGTGAATGCACAGGGGCTCACACCATTGGAATGGCACGCTGTGTGAATTACCGTAAGAGAATTTATGGA
GACTACAGGGTAACTTCAGGCATAAATCCATTATCCGAGACACATCTCAGCGTGTTGAAATCAATATGTCCACCCATTGGAAGTGACAATAACGAAACAGCAATGGATTATGAGACACCA
AATCTTTTCGACAATTCCTTTTACCAGATACTTCTGCAAGGAGAAGGACTGCTGAATTCTGACCAAGAAATGTACTCGAGCATTTTCGGAATCCAAACAAAGGAGCTTGTGAATAAGTAT
GCACATGACGCTCTTGGTTTCTTCCAGCAATTCTCTGATTCGATGGTGAAGATGGGAAATATTACAAACCCAGAAAGCTTTGTCAATGGGGAAGTGAGAAAGAATTGCAGATTTGTGAAC
ACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAATTCTCTTCATCATCCTAGGCTTCCAATTTTGCAATTTTTGCTTTTGGTTTTCTCAAGTTTTATCCCCCGGTTGCATGCAAGTGAACCTTATTTGACGTTGGATTACTATGCA
AAGACTTGCCCGACTGCGTTCGAGATTGTGAGAAAAGAAATGGAATGTGCTGTGCTTTCGGATCCGCGCAACGCCGCCCTTATAGTCCGACTACACTTCCATGATTGCTTTGTACAG
GGA
TGTGACGGGTCAGTTTTACTAGACGATACTATCGACTTACAAGGAGAAAAAAAGGCTTCTATTAACAGAAACGCCCTGAAAGGTTTTAGGATTATAGACAGGATCAAGAACAAGATCGAA
TCCGATTGCCCTGGAATCGTCTCTTGTGCAGATATTCTCACCATTGCTGCTAGAGACGCAATCATTCTG
GTTGGTGGACCTTATTGGGATGTTCCAGTGGGAAGAAAGGACTCTAAAACT
GCAAGCTATGCATTAGCAGACTCGAATCTGCCCAGTCCAGATGAGGGCCTCCTCTCTATTATTTCTAAGTTTCATTATCAAGGCCTATCTGTCACCGATATGGTGGCTCTTTCAG
GGGCT
CACACCATTGGAATGGCACGCTGTGTGAATTACCGTAAGAGAATTTATGGAGACTACAGGGTAACTTCAGGCATAAATCCATTATCCGAGACACATCTCAGCGTGTTGAAATCAATATGT
CCACCCATTGGAAGTGACAATAACGAAACAGCAATGGATTATGAGACACCAAATCTTTTCGACAATTCCTTTTACCAGATACTTCTGCAAGGAGAAGGACTGCTGAATTCTGACCAAGAA
ATGTACTCGAGCATTTTCGGAATCCAAACAAAGGAGCTTGTGAATAAGTATGCACATGACGCTCTTGGTTTCTTCCAGCAATTCTCTGATTCGATGGTGAAGATGGGAAATATTACAAAC
CCAGAAAGCTTTGTCAATGGGGAAGTGAGAAAGAATTGCAGATTTGTGAACACATAA

Retrieve as FASTA