Entry information : CclPrx94 (clementine0.9_030159m)
Entry ID 8724
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-05 (Qiang Li)
Peroxidase information: CclPrx94 (clementine0.9_030159m)
Name (synonym) CclPrx94 (clementine0.9_030159m)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx94
start..stop
S start..stop
CsPrx04 667 0 1..335 1..334
PtPrx08 523 0 5..330 7..331
CsPrx36 519 0 23..328 25..329
CclPrx33 516 0 23..328 25..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3881312..3881393 82 N° 2 3881819..3881967 149 N° 3 3882102..3882290 189 N° 4 3882388..3882553 166
N° 5 3882647..3883068 422  
join(3881312..3881393,3881819..3881967,3882102..3882290,3882388..3882553,3882647 ..3883068)


exon

Literature and cross-references CclPrx94 (clementine0.9_030159m)
DNA ref. Phytozome 12:   scaffold_23 (3881312..3883068)
Protein sequence: CclPrx94 (clementine0.9_030159m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (305)
PWM (Da):   %s   37329.69 (33856.9)  
PI (pH):   %s   6.67 (6.17) Peptide Signal:   %s   cut: 31 range:31-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATKRHHHLCSSYFLLLLPLLLQFYSGSESQLQFNYYAESCPKAEDIIKQQVINLYNKHGNTAVSWVRNLFHDCIVSCDASLLLKKAGGIVSEQASERSFGMRNFRYVDTIKEALEEECPVTVSCADIVALSAREGIVMLGGPRIEMKTGRKDSRESYFTEVDKLIPNHNDSLSTVLSAFQSTGIDVEGTVALLGAHSVGGVHCVNLVHRLYPTVGPSLNPEYGEYLKRRCPTPNPDPKTVLYARNDPETPMIIDNNYYKNLLNQKGLLIVDQQLASDPRTAPFVEKMAADNGYFHQQFSRAVGLLSENNPLTEDQGEIRKDCRYANSNTNNVY

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (A short 5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTAAGAGGCATCATCATCTTTGCTCAAGCTACTTCTTGCTGCTATTACCGTTGCTTTTGCAGTTTTATTCTGGTATTTTACTAATATATATATATATACACTCTCTTATATGA
GATGGTGGGGAAATTTAGCACTTTTATTGCGGTAGTTACTTTTTCAGAAAATTGTTTTCGGGTACTTATGAACTGAAAAAGAAAAGCNNNNNNNNNNNNNNNNNNNNNNNGACATAGTAA
TAAAATGAGATGTGTGTGTTCTTGTATATTCAGTGTGCCATTCATTTGAATGTTTATAAATAAAAATACACACGGCTACGCGGAAAAAAAAAAATTGTTTTTAATATACATACACGTAAT
CCTAATTGAAATAAAGTGTGCCACGAGCTACACATCCGCTAACATTTTGATTTGCTTTCTGAAATATTTTCTATGTAGCATGTTATAAATATACATATACCATNNNNNNNNNNNNNNNNN
NNNNNNTCTTGTTTGAATTTGACGCAGGTGAAAGCCAGCTCCAGTTTAATTATTATGCAGAGAGTTGTCCGAAAGCAGAGGACATCATAAAACAACAGGTCATTAACCTATACAACAAAC
ATGGAAACACAGCAGTCTCGTGGGTCAGAAATCTTTTCCACGATTGCATCGTCAAG
GTTCGTATACATACATACATATATATATAGAACTCACATAGCATAATTTTGTTATCTTTAATAT
TGTCATATTGATATAATGATCATAGCTTTGTTAATTTGCTACAACAATTAAGCTGCCCAAAAATTTGCAGTCATGTGATGCGTCGCTCTTGCTGAAGAAAGCGGGTGGTATTGTATCAGA
GCAGGCATCGGAAAGAAGTTTCGGCATGAGGAATTTCAGGTATGTGGACACAATCAAAGAAGCCCTCGAAGAAGAATGCCCAGTGACTGTTTCTTGTGCTGATATCGTCGCCCTGTCTGC
TAGAGAGGGCATTGTGATG
GTACGTTAATTATTGCAAATAAAGAATAAAAAAAACTGATGCAACATTTAGTAGATTGAAATGAATATTGAATAGTGGGTGGGCGTGTTACTCACAGCTGG
GAGGACCACGCATTGAAATGAAAACCGGGCGGAAAGATAGCAGGGAAAGTTACTTCACAGAGGTGGACAAGTTGATCCCTAACCACAACGATAGCTTATCCACAGTGCTTTCTGCTTTTC
AATCTACTGGCATTGACGTTGAGGGAACTGTTGCTCTCCTAG
GTATATATTTTTAATTTCTTGTTTCATCATGAGCTTGACTGAATTGAAGTTTCTAAACTTTTACGAAAAAACTGGCTT
CTGTTTTCTGTGCAGGAGCCCACTCTGTAGGAGGAGTTCATTGTGTCAATCTAGTGCACAGACTCTATCCCACCGTCGGTCCAAGTTTAAATCCGGAATACGGAGAATACCTAAAACGCC
GATGTCCAACGCCAAATCCGGATCCAAAGACAGTGTTATATGCGAGAAACGACCCAGAAACGCCCATGATTATCGATAACAACTACTACAAGAACTTGCTAAACCAAAAGGGATTACTCA
TTGTTGATCAACAATTAGCTTCTGATCCAAGAACCGCTCCTTTTGTTGAAAAGATGGCTGCTGATAATGGCTATTTCCACCAACAGTTTTCGAGGGCTGTGGGCTTGTTATCCGAGAATA
ATCCGCTTACTGAAGACCAAGGGGAAATAAGAAAGGATTGTCGTTATGCAAATAGCAATACTAACAATGTTTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTAAGAGGCATCATCATCTTTGCTCAAGCTACTTCTTGCTGCTATTACCGTTGCTTTTGCAGTTTTATTCTGGTAGTGAAAGCCAGCTCCAGTTTAATTATTATGCAGAGAGT
TGTCCGAAAGCAGAGGACATCATAAAACAACAGGTCATTAACCTATACAACAAACATGGAAACACAGCAGTCTCGTGGGTCAGAAATCTTTTCCACGATTGCATCGTCAAG
TCATGTGAT
GCGTCGCTCTTGCTGAAGAAAGCGGGTGGTATTGTATCAGAGCAGGCATCGGAAAGAAGTTTCGGCATGAGGAATTTCAGGTATGTGGACACAATCAAAGAAGCCCTCGAAGAAGAATGC
CCAGTGACTGTTTCTTGTGCTGATATCGTCGCCCTGTCTGCTAGAGAGGGCATTGTGATG
CTGGGAGGACCACGCATTGAAATGAAAACCGGGCGGAAAGATAGCAGGGAAAGTTACTTC
ACAGAGGTGGACAAGTTGATCCCTAACCACAACGATAGCTTATCCACAGTGCTTTCTGCTTTTCAATCTACTGGCATTGACGTTGAGGGAACTGTTGCTCTCCTAG
GAGCCCACTCTGTA
GGAGGAGTTCATTGTGTCAATCTAGTGCACAGACTCTATCCCACCGTCGGTCCAAGTTTAAATCCGGAATACGGAGAATACCTAAAACGCCGATGTCCAACGCCAAATCCGGATCCAAAG
ACAGTGTTATATGCGAGAAACGACCCAGAAACGCCCATGATTATCGATAACAACTACTACAAGAACTTGCTAAACCAAAAGGGATTACTCATTGTTGATCAACAATTAGCTTCTGATCCA
AGAACCGCTCCTTTTGTTGAAAAGATGGCTGCTGATAATGGCTATTTCCACCAACAGTTTTCGAGGGCTGTGGGCTTGTTATCCGAGAATAATCCGCTTACTGAAGACCAAGGGGAAATA
AGAAAGGATTGTCGTTATGCAAATAGCAATACTAACAATGTTTACTGA

Retrieve as FASTA