Entry information : SbPrx53 (Sobic.003G121000.1 [2.1] / Sb03g010240 [1.4])
Entry ID 874
Creation 2008-10-16 (Christophe Dunand)
Last sequence changes 2008-10-16 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx53 (Sobic.003G121000.1 [2.1] / Sb03g010240 [1.4])
Name (synonym) SbPrx53 (Sobic.003G121000.1 [2.1] / Sb03g010240 [1.4])
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer Phosphate starvation
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx53
start..stop
S start..stop
SiPrx15 611 0 1..336 1..338
SiPrx17 609 0 1..335 1..334
SbPrx54 609 0 1..335 1..334
SiPrx14 601 0 1..336 1..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11089639..11089869 231 N° 2 11090808..11091587 780  
join(11089639..11089869,11090808..11091587)


exon

Literature and cross-references SbPrx53 (Sobic.003G121000.1 [2.1] / Sb03g010240 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_3 (11089639..11091587)
Protein sequence: SbPrx53 (Sobic.003G121000.1 [2.1] / Sb03g010240 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (311)
PWM (Da):   %s   35828.21 (33207.9)  
PI (pH):   %s   8.86 (8.75) Peptide Signal:   %s   cut: 26 range:26-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASMSHRCHMLLLCVVLLAGAVRGHPWGGGLFPQFYDHSCPKAKEIVRSVVAQAVARETRMAASLVRLHFHDCFVKGCDASVLLDNSSSIVSEKGSNPNKNSLRGFEVVDQIKAALEAACPGVVSCADILALAARDSTVLVGGPSWDVPLGRRDSLGASIQGSNNDIPAPNNTLPTIVTKFRRQGLDVADVVALSGGHTIGMSRCTSFRQRLYNQTGNGMADATLDVSYAAQLRRGCPRSGGDNNLFPLDLATPARFDNLYFKNILAGRGLLSSDEVLLTKSAETAALVKAYAADVNLFFQHFAQSMVKMGNISPLTGPQGEIRKNCRRINGNHY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 1) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTTCCATGAGTCATCGTTGTCACATGCTGCTGCTCTGCGTCGTCCTCCTCGCCGGCGCCGTCCGTGGCCACCCTTGGGGCGGCGGCCTGTTCCCGCAGTTCTACGACCACTCG
TGTCCCAAGGCGAAGGAGATCGTTAGGTCCGTCGTGGCGCAGGCCGTCGCCAGGGAGACCAGGATGGCGGCGTCACTTGTCAGGCTGCATTTCCATGACTGCTTCGTCAAG
GTACCTACT
ATAGCTAGTAAATAAACCCTGCTTTCCGGCACTGTAGTTTTCGTTACATTACATGCAGCTAAGCAGCTCTGAATATCTTATGCATGTTAGTTAACAATAGGTACATGATGACTGAATATG
CAAAGTGCACCGCTGCAACTTTTGCTGTTTGAGTGAGCAAATCCCTAGTTCTTTTTGCTACCTTTTTACCAACAAAGATATGATGACGACCTAGCTACACATTGCGCATGCATGCCAGCA
CTAGTTTATGTCTTGCCGTTGGCGACAACATTACAATGCAATATCATATCCCGTATCGTATGATTGATTCAGGCCTTGTTTTGGCAAAACTTTTTAGTTTCGTTTGTATTTGATAAATAT
TGTTGTTTAATTATGCTTATGAACTAACTAAGGTTAAAAGATTCATCTCGCAAATTACAAACAAACTGTGTAATTAGTTTTTGTTTTCATCTATATCTAATACTTCATACATGACCGTAA
AATTTGATGGGACGAAAAATCTTTAAAAAATTATACTCAATCCATTCCAAATTGTAAGTCGTTTGACTTTTTTAATATCAAGTTTGACCACTCGTCTTATTCAAAGTTTTGTACAAAATA
TTACTTTTTTTTTGTTGTGTATTGGTTTATTAATAAAAGTTCTTCAAGAATGACTTAAATTTGACTATATTTGCATAAATTTTTTGAATAAGACGAGTGGTCAAACTTGGGGTAAAAAAA
GTCAAATGACTTACAATTTGGGATGGAGGGAGTATTTTTAGGAACTAAGCAAAGCCTCATTCCTCTCTCTCTGTTTTTTTTTGTTGCCCTTTTCTCAAAAAGAGAGAAAACTATCGTCAA
TGTAGGTGCCTAATTAATGAGTCGTCTACCACCATGATTGTCAAATTAACCTTTTGCAACACTTTTCCATCCGTGTGTATCTCTGATAGGGCTGCGACGCTTCTGTGCTGCTGGACAACA
GCAGCAGCATCGTGAGCGAGAAAGGCTCCAACCCCAACAAGAACTCGCTTCGTGGCTTCGAGGTCGTGGACCAGATCAAGGCCGCGCTGGAGGCCGCGTGCCCGGGCGTCGTCTCCTGCG
CCGACATCCTCGCCCTGGCCGCGCGCGACTCCACGGTGCTCGTCGGCGGTCCATCCTGGGACGTGCCGCTGGGGCGGAGGGACTCGCTGGGCGCCAGCATCCAGGGCTCCAACAACGACA
TCCCGGCGCCCAACAACACGCTCCCCACCATCGTCACCAAGTTCAGGCGCCAGGGCCTGGACGTCGCCGACGTCGTCGCGCTCTCCGGCGGCCACACCATCGGCATGTCCCGCTGCACCA
GCTTCAGGCAGAGGCTCTACAACCAGACGGGCAACGGCATGGCGGACGCCACGCTGGACGTCTCCTACGCGGCGCAGCTGAGGCGGGGATGCCCGCGCTCCGGCGGCGACAACAACCTCT
TCCCGCTCGACCTCGCCACCCCGGCCAGGTTCGACAACCTCTACTTCAAGAACATCCTGGCCGGAAGGGGGCTGCTCAGCTCCGACGAGGTGCTGCTCACCAAGAGCGCCGAGACGGCGG
CGCTCGTCAAGGCCTACGCCGCGGACGTCAACCTCTTCTTCCAGCACTTCGCGCAGTCGATGGTGAAGATGGGCAACATCTCGCCGCTGACGGGGCCGCAGGGGGAGATCAGGAAGAACT
GCAGGAGGATTAACGGCAACCATTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTTCCATGAGTCATCGTTGTCACATGCTGCTGCTCTGCGTCGTCCTCCTCGCCGGCGCCGTCCGTGGCCACCCTTGGGGCGGCGGCCTGTTCCCGCAGTTCTACGACCACTCG
TGTCCCAAGGCGAAGGAGATCGTTAGGTCCGTCGTGGCGCAGGCCGTCGCCAGGGAGACCAGGATGGCGGCGTCACTTGTCAGGCTGCATTTCCATGACTGCTTCGTCAAG
GGCTGCGAC
GCTTCTGTGCTGCTGGACAACAGCAGCAGCATCGTGAGCGAGAAAGGCTCCAACCCCAACAAGAACTCGCTTCGTGGCTTCGAGGTCGTGGACCAGATCAAGGCCGCGCTGGAGGCCGCG
TGCCCGGGCGTCGTCTCCTGCGCCGACATCCTCGCCCTGGCCGCGCGCGACTCCACGGTGCTCGTCGGCGGTCCATCCTGGGACGTGCCGCTGGGGCGGAGGGACTCGCTGGGCGCCAGC
ATCCAGGGCTCCAACAACGACATCCCGGCGCCCAACAACACGCTCCCCACCATCGTCACCAAGTTCAGGCGCCAGGGCCTGGACGTCGCCGACGTCGTCGCGCTCTCCGGCGGCCACACC
ATCGGCATGTCCCGCTGCACCAGCTTCAGGCAGAGGCTCTACAACCAGACGGGCAACGGCATGGCGGACGCCACGCTGGACGTCTCCTACGCGGCGCAGCTGAGGCGGGGATGCCCGCGC
TCCGGCGGCGACAACAACCTCTTCCCGCTCGACCTCGCCACCCCGGCCAGGTTCGACAACCTCTACTTCAAGAACATCCTGGCCGGAAGGGGGCTGCTCAGCTCCGACGAGGTGCTGCTC
ACCAAGAGCGCCGAGACGGCGGCGCTCGTCAAGGCCTACGCCGCGGACGTCAACCTCTTCTTCCAGCACTTCGCGCAGTCGATGGTGAAGATGGGCAACATCTCGCCGCTGACGGGGCCG
CAGGGGGAGATCAGGAAGAACTGCAGGAGGATTAACGGCAACCATTACTGA

Retrieve as FASTA