Entry information : CpapPrx26 (evm.model.supercontig_26.281)
Entry ID 8758
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2015-12-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-02 (Achraf Jemmat)
Peroxidase information: CpapPrx26 (evm.model.supercontig_26.281)
Name (synonym) CpapPrx26 (evm.model.supercontig_26.281)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx26
start..stop
S start..stop
CsPrx27 558 0 9..321 4..316
MePrx114 555 0 18..321 16..319
CclPrx51 552 0 9..321 4..316
PtPrx65 547 0 11..322 6..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1856134..1856352 219 N° 2 1856454..1856642 189 N° 3 1856827..1856989 163 N° 4 1857118..1857512 395
join(1856134..1856352,1856454..1856642,1856827..1856989,1857118..1857512)


exon

Literature and cross-references CpapPrx26 (evm.model.supercontig_26.281)
DNA ref. Phytozome 12:   supercontig_26 (1856134..1857512)
Protein sequence: CpapPrx26 (evm.model.supercontig_26.281)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (295)
PWM (Da):   %s   34999.93 (31906.2) Transmb domain:   %s   i9-28o
PI (pH):   %s   9.43 (9.28) Peptide Signal:   %s   cut: 28 range:28-322
Sequence 363
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYIHMAQRLLALVFTLLIFQVFSSVTALSSNYYDHTCPQLESAVTDAVKKAMMNDKTVPAALLRMHFHDCFIRGCDASVLLKSKGKNKAEKDGPPNISLHAFYVIDNAKKAVEAMCPGVVSCADILALAARDAVALSGGRTWEVPKGRKDGRISRASDTRQLPAPTFNISQLQQNFAQRGLSIEDLVALSGGHTLGFSHCSSFQNRIHNFNATVDIDPALNPSFAASLRSVCPVHNKVKNAGATIDSSTFNFDNVYYKLLLQGKSLFSSDQALLTTPKTRALVTKFASSKHEFEKAFVQSMIKMSSITGGGQEIRLDCKVVR

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from Phytozome (extra first intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTATATACATATGGCACAAAGACTACTTGCATTGGTTTTTACCCTCCTCATATTTCAAGTTTTTTCTTCAGTTACTGCACTGAGCTCAAATTACTACGATCACACATGCCCTCAACTCG
AATCCGCTGTCACCGATGCTGTCAAGAAAGCAATGATGAATGATAAAACAGTTCCTGCCGCCCTACTGCGAATGCATTTTCATGATTGCTTTATCAGA
GTAATTAGAGACCCGCATACAT
TCATGCCTACAAAATTTATATTAGTTTAATCAGTTAATTATAATTGATTTACTTGATGATGTGTTGGTCGTTTTTTAAGGGGTGTGATGCATCAGTGTTGCTGAAATCAAAGGGAAAGAA
CAAAGCAGAGAAAGATGGACCTCCTAATATTTCATTGCATGCATTTTATGTGATTGATAATGCTAAGAAAGCAGTTGAAGCTATGTGTCCTGGTGTCGTCTCCTGCGCTGACATCTTGGC
TCTCGCTGCTAGAGATGCTGTTGCTTTG
GTTACTTCTTTTTTTCCTTACTCCAATTTTTAAAGCCATGTCAATTATAACAAATACAATTTCTGATTTGGGTTTAGTCTGATGTGGTCCTT
TGTGTCAGTTCTACATACGTAAAGGTGATATATATTTTTATATAGGTACAGTTAACATGGGAAACTTACGTGTTTGGTATGTGATGGTGCAGTCAGGAGGTCGTACTTGGGAAGTTCCAA
AAGGGAGAAAAGATGGAAGAATATCGAGGGCAAGTGATACCAGACAATTACCAGCTCCCACCTTCAACATTTCTCAACTCCAGCAGAACTTTGCCCAAAGAGGTCTCTCCATCGAAGATC
TAGTTGCTCTCTCAG
GTCCAATTCAAAATAGATATATATATATATATATATTTAACATCCTATGAAAAGTATCTATCTTTTCTATTATGATTGGGGAAAAAATATATAAAATATATAATA
AGCCAAATTTATAAACATGACAGGAGGACATACTCTTGGGTTCTCCCACTGTTCATCCTTCCAGAACAGAATTCACAATTTCAATGCCACCGTAGACATCGACCCAGCACTGAACCCAAG
CTTTGCAGCCAGCTTGAGAAGTGTATGCCCAGTCCACAACAAGGTTAAAAACGCGGGTGCCACCATTGATTCTTCAACCTTTAACTTCGACAATGTTTATTACAAACTTCTTCTTCAAGG
CAAGAGTCTTTTCTCTTCGGATCAAGCTCTGCTCACCACTCCCAAAACCAGAGCACTTGTGACTAAGTTCGCTAGCTCTAAGCATGAGTTTGAGAAGGCTTTTGTCCAGTCCATGATCAA
GATGAGCAGCATCACCGGCGGCGGCCAAGAGATCAGGCTGGACTGTAAAGTTGTTAGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTATATACATATGGCACAAAGACTACTTGCATTGGTTTTTACCCTCCTCATATTTCAAGTTTTTTCTTCAGTTACTGCACTGAGCTCAAATTACTACGATCACACATGCCCTCAACTCG
AATCCGCTGTCACCGATGCTGTCAAGAAAGCAATGATGAATGATAAAACAGTTCCTGCCGCCCTACTGCGAATGCATTTTCATGATTGCTTTATCAGA
GGGTGTGATGCATCAGTGTTGC
TGAAATCAAAGGGAAAGAACAAAGCAGAGAAAGATGGACCTCCTAATATTTCATTGCATGCATTTTATGTGATTGATAATGCTAAGAAAGCAGTTGAAGCTATGTGTCCTGGTGTCGTCT
CCTGCGCTGACATCTTGGCTCTCGCTGCTAGAGATGCTGTTGCTTTG
TCAGGAGGTCGTACTTGGGAAGTTCCAAAAGGGAGAAAAGATGGAAGAATATCGAGGGCAAGTGATACCAGAC
AATTACCAGCTCCCACCTTCAACATTTCTCAACTCCAGCAGAACTTTGCCCAAAGAGGTCTCTCCATCGAAGATCTAGTTGCTCTCTCAG
GAGGACATACTCTTGGGTTCTCCCACTGTT
CATCCTTCCAGAACAGAATTCACAATTTCAATGCCACCGTAGACATCGACCCAGCACTGAACCCAAGCTTTGCAGCCAGCTTGAGAAGTGTATGCCCAGTCCACAACAAGGTTAAAAACG
CGGGTGCCACCATTGATTCTTCAACCTTTAACTTCGACAATGTTTATTACAAACTTCTTCTTCAAGGCAAGAGTCTTTTCTCTTCGGATCAAGCTCTGCTCACCACTCCCAAAACCAGAG
CACTTGTGACTAAGTTCGCTAGCTCTAAGCATGAGTTTGAGAAGGCTTTTGTCCAGTCCATGATCAAGATGAGCAGCATCACCGGCGGCGGCCAAGAGATCAGGCTGGACTGTAAAGTTG
TTAGA

Retrieve as FASTA