Entry information : SbPrx60 (Sobic.003G151900.1 [2.1] / Sb03g013190 [1.4])
Entry ID 878
Creation 2008-10-20 (Christophe Dunand)
Last sequence changes 2008-10-20 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx60 (Sobic.003G151900.1 [2.1] / Sb03g013190 [1.4])
Name (synonym) SbPrx60 (Sobic.003G151900.1 [2.1] / Sb03g013190 [1.4])
Class Class III peroxidase    [Orthogroup: Prx102]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx60
start..stop
S start..stop
ZmPrx01_lineC 592 0 3..370 2..367
SiPrx05 568 0 30..371 26..359
ZmPrx01_W64A 557 0 37..370 12..344
HvPrx10 494 3e-177 17..341 8..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16095935..16096180 246 N° 2 16098268..16098708 441 N° 3 16098838..16099266 429  
join(16095935..16096180,16098268..16098708,16098838..16099266)


exon

Literature and cross-references SbPrx60 (Sobic.003G151900.1 [2.1] / Sb03g013190 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_3 (16095935..16099266)
Protein sequence: SbPrx60 (Sobic.003G151900.1 [2.1] / Sb03g013190 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371
PWM (Da):   %s   38532.23 Transmb domain:   %s   i13-35o
PI (pH):   %s   6.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKESKLTTTAGVAQRLAVVAACVLCLLPAMAHAQLRVGFYDTSCPNAEALVRQAVAAAFAKDAGIAAGLIRLHFHDCFVRGCDASVLLTVNPGGGQTERDAVPNNPSLRGFDVIDAAKAAVEQSCPGTVSCADIVAFAARDSISLTGSVSYQVPAGRRDGRVSNSSDTVDLPAPSSTAQTLIDKFAAKDLTLEDMVVLSGAHTVGRSFCVSFFQRVWNTSTNPATAIVDAGLSSSYAALLRALCPSNTTQTTPITTAMDPGTPNVLDNNYYKLLPRGMGLFFSDNQLRVNTQMAALVSSFAANETLWKEKFAAAMVKMGRIQVQTGACGEVRLNCGVVNPSSYSSPSTVVELGSSAPAAVDEEGYAAAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, introns 1 and 3') and 2 ESTs. Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTAAGGAAAGCAAGCTGACGACGACGGCCGGAGTGGCCCAGCGGCTGGCCGTCGTCGCCGCGTGCGTACTATGCCTGCTGCCGGCGATGGCCCACGCGCAGCTCCGGGTGGGA
TTCTACGACACCAGCTGCCCTAACGCCGAGGCGCTCGTCCGCCAGGCCGTCGCGGCTGCCTTCGCCAAGGACGCCGGCATCGCCGCCGGCCTCATCCGCCTCCATTTCCACGACTGCTTT
GTCAGG
GTACGTAACAAAGCTTAATTTACTGCCTCGCTTTTCTTTTGATTTACTTAATTTATTACCACCTGCAGCTTTATTTAGGTAGTGGACGTAGTACATGAAAAGACGAGCTGAAAC
GCAAAGGTGCCCATGCTGTAATGGCAATGCTGAAAAGACGCAAGAAATATATAGCGCGAAATAAAATGAATCAAGAAAAACTTACTCAAACCACAGTTCTTGTGACTTGTCAACACATGT
ATGCCTTTTAATTCTGCCTTCATCCAATGACTAGCTAGATCTCACTTCTATATGGCACACAAATATTATATATGTTTCTGTTCCACGATTGATGCGTTGAGTAATATCAATTGATCTGTC
CCCACTCGCTAATCACAACATGCATCAGAATATGAGATATATATTGCTGAAGCATATCTAACAAAAATCTCACGACATTATCAATTTGCCTTTTGTGCTTATCCTAGTTACTTTCCATTG
TAAACCCTCCTAGCTACCAGTACAAACTTACAAAGATTCACCAACTTTTAATTTGCGTGGCCTGGAATCCAAAATTTCTAAATATAAAATATTTGTTATGAACATACATTTATTTGTATA
ATACGATACCTGGCTGCACTTTTACAGAAATTTGTTGGTACCATACTACCATAGTATATTGGAAAGCAAAAAAAAAAAAAAAAGCGAAAGTTGTTTTCTCAAGACAAAGAGACAAAGTGT
CCAAAGCAAAAGCCCAAAAACCAAGTGAACGCATAGATACATTTGCTCTGCTGCTTTCTTTCTTGGAAGGCAACGCATATTCGCTGCTTGCAACTGTTGCCAAGAATAAGCTTTTTATCT
TTGAGCACCAAGAATAACCTTTTATGAGACGAACCGACAATCTCACTCTTTATTTTTTTTATTATCTTCCGAGCATAAACATTCTTGGATGATAGTATCAAAATTAAGACATCCAAACTA
AAGGACAGAAGCATAAACATCCATGTTTCCTAGCTAGCTGGTACCAGTATATTGTTTATTGAAGTAGCAAATGCATGGATAGTAGGAGTATTGCGCTGCAAACCTCAAGACACTTGTAGT
AGGAAAAAATATGAAACATTTTATAACTCTATCGCTTTATACACTATGTGAAATTGAATGTTAAATTTGTACTTCATCTGTTCTAAATTATGTCTTTTCTAGATATGTTTTTGTTATATG
TCTAGACGTAGTGTATACATTGGAATGCTTGGAAGCAGGTAACTGATGCTTCAAGATCAAGTATCGAAGCAGAATCCAGGATTTCTTTATCCTTAACATTGAGAGCGGTAACACTTGCAT
GATTATAGAGAAGATCGCCCCCCCATAATACTTGTTTCAAATATAGAGAACTTTCTATCTGACTAGGTACATTGCTGCTATATACTTAAAAAAACAAAAATGACTTATAGTTTAAAATAG
ATGAAGTACTTTGGAAGATATCAAGCAGAAACTATTGAAAAACAACATTTCAAAGACATTAATATTTTCCTTATATACCGTGTTTATTTGTGACCTAAGGGGATTGTGGGTTAAAAAGGA
AGGAAAATGACCATATCACAAAAATAGCTTTAGTTTTGTTATAAGTTAATAGAAAAATGTATAAACATCTATAAATTATAAACAAGATTCATTCAATACACCATGAAATCTATTTGATAG
CATGTTTATACATATTTAATATATATTGTAGATCTTAATATATTTTCTATAAACTTGATTAAAGTTACAAGGTTGACTTAAAACAAAACTAAAATGATTCATGATTTGAAATGAATTGAG
TAAAATTCAATATCATTCTTAGGCAAACTATCATAAATTTGACAAAATATAAAAAAGTATTAACATCTATAAGTATGCTATATGAAAATATATGCCAAGGAATCTATGTAATGATGCTTA
AGTGATATCTTAGATAGTATTACTTTTTCCCTAAAATTTTATATTAGCTAATCTTGTGATTATATAATAGTTTAATTTAGAATAGATAAACTAAAAGTCTTTAAGTGGATTTGTTTGGTG
CCAATCAACGAGGTATTCTTGACTGACCTTCGTCTTCCGACACGACTGTGCAGGGCTGTGATGCCTCCGTCCTCCTCACCGTGAACCCTGGCGGCGGCCAGACCGAGCGTGACGCCGTGC
CAAACAACCCGAGCCTCCGCGGCTTCGACGTGATCGACGCCGCCAAGGCCGCCGTTGAGCAGAGCTGCCCGGGCACCGTGTCGTGCGCCGACATCGTGGCCTTCGCCGCCCGCGACAGCA
TCAGCCTCACCGGGAGCGTCTCGTACCAGGTCCCCGCCGGCCGGCGCGACGGCCGCGTGTCCAACTCGTCGGACACCGTCGACCTGCCCGCGCCCAGCTCCACAGCGCAGACCCTCATCG
ACAAGTTCGCGGCCAAGGACCTCACCTTGGAGGACATGGTGGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCCTTCTGCGTCTCCTTCTTCCAGCGCGTCTGGAACACAAGCACGAACC
CCGCTACGGCAATC
GTACGTGTACTACGCCGACATGGCTGACGACGACGATGCATCGCCACCGGCCAATTCACCACTCACGCTCACGCATGACGACGACGCATATATGTGACACGTGCCG
TGTATGTGTGCGTGTGTGCGCAGGTGGACGCGGGGCTGAGCTCGTCGTACGCGGCGCTGCTACGCGCGCTGTGCCCGTCGAACACGACGCAGACGACGCCGATCACGACGGCCATGGATC
CCGGGACGCCCAACGTGCTGGACAACAACTACTACAAGCTCCTGCCACGCGGCATGGGGCTCTTCTTCTCCGACAACCAGCTGCGCGTGAACACGCAGATGGCCGCGCTGGTGAGCAGCT
TCGCGGCGAACGAGACGCTGTGGAAGGAGAAATTCGCGGCGGCGATGGTGAAGATGGGCCGCATCCAGGTGCAGACGGGGGCGTGCGGGGAGGTCCGTCTCAACTGCGGCGTCGTCAACC
CGAGTTCATACTCGTCGCCGTCGACGGTGGTGGAGCTGGGTTCGAGCGCGCCAGCCGCCGTCGATGAAGAGGGCTACGCCGCCGCGAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTAAGGAAAGCAAGCTGACGACGACGGCCGGAGTGGCCCAGCGGCTGGCCGTCGTCGCCGCGTGCGTACTATGCCTGCTGCCGGCGATGGCCCACGCGCAGCTCCGGGTGGGA
TTCTACGACACCAGCTGCCCTAACGCCGAGGCGCTCGTCCGCCAGGCCGTCGCGGCTGCCTTCGCCAAGGACGCCGGCATCGCCGCCGGCCTCATCCGCCTCCATTTCCACGACTGCTTT
GTCAGG
GGCTGTGATGCCTCCGTCCTCCTCACCGTGAACCCTGGCGGCGGCCAGACCGAGCGTGACGCCGTGCCAAACAACCCGAGCCTCCGCGGCTTCGACGTGATCGACGCCGCCAAG
GCCGCCGTTGAGCAGAGCTGCCCGGGCACCGTGTCGTGCGCCGACATCGTGGCCTTCGCCGCCCGCGACAGCATCAGCCTCACCGGGAGCGTCTCGTACCAGGTCCCCGCCGGCCGGCGC
GACGGCCGCGTGTCCAACTCGTCGGACACCGTCGACCTGCCCGCGCCCAGCTCCACAGCGCAGACCCTCATCGACAAGTTCGCGGCCAAGGACCTCACCTTGGAGGACATGGTGGTCCTC
TCCGGCGCCCACACCGTCGGCCGCTCCTTCTGCGTCTCCTTCTTCCAGCGCGTCTGGAACACAAGCACGAACCCCGCTACGGCAATC
GTGGACGCGGGGCTGAGCTCGTCGTACGCGGCG
CTGCTACGCGCGCTGTGCCCGTCGAACACGACGCAGACGACGCCGATCACGACGGCCATGGATCCCGGGACGCCCAACGTGCTGGACAACAACTACTACAAGCTCCTGCCACGCGGCATG
GGGCTCTTCTTCTCCGACAACCAGCTGCGCGTGAACACGCAGATGGCCGCGCTGGTGAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAATTCGCGGCGGCGATGGTGAAGATG
GGCCGCATCCAGGTGCAGACGGGGGCGTGCGGGGAGGTCCGTCTCAACTGCGGCGTCGTCAACCCGAGTTCATACTCGTCGCCGTCGACGGTGGTGGAGCTGGGTTCGAGCGCGCCAGCC
GCCGTCGATGAAGAGGGCTACGCCGCCGCGAGCTAA

Retrieve as FASTA