Entry information : CsaPrx10 (Cucsa.000230.1)
Entry ID 8801
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: CsaPrx10 (Cucsa.000230.1)
Name (synonym) CsaPrx10 (Cucsa.000230.1)
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx10
start..stop
S start..stop
CsaPrx11 542 0 17..320 17..320
PpePrx54 459 1e-164 8..320 9..322
PtPrx39 456 6e-163 9..320 7..319
PpePrx43 451 5e-161 5..320 4..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20187..20399 213 N° 2 19883..20077 195 N° 3 19250..19804 555  
complement(join(19250..19804,19883..20077,20187..20399))


exon

Literature and cross-references CsaPrx10 (Cucsa.000230.1)
DNA ref. Phytozome 12:   scaffold00009 (20399..19250)
Protein sequence: CsaPrx10 (Cucsa.000230.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320
PWM (Da):   %s   34968.6  
PI (pH):   %s   8.63
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASIIHSLLLCFIVLSASLSHTHAQLTPNFYNNVCPRALSTIKSVVSKAIRREPRMGASLLRLHFHDCFVNGCDGSVLLDDTATFTGEKTAFPNANSIRGFDVVDQIKTQVNKVCKENVVSCADILAVAARDSVAILGGPNYKVLVGRRDARTASANDANRNLPPPFFSFSQLLSNFQSHGLELKDLVLLSAGHTLGLARCTSFRSRIYNDTNIDSKFATTLQKNCPQSGGDDNLKGLDKSPNFFDNAYFKALLTNKGLLHSDQELFGGGNNDSDDLVKYYSRYPNDFKKDFGSSMIKMGNMNPLTGTNGEIRTNCRFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCATTATCCACTCTCTTTTGCTTTGTTTTATTGTTTTATCAGCTTCCCTAAGCCATACCCATGCACAACTAACTCCAAACTTTTACAACAACGTCTGCCCAAGGGCCTTGTCC
ACCATTAAATCCGTCGTTTCGAAGGCCATCAGGCGCGAGCCTCGAATGGGTGCTTCGCTATTACGTCTCCATTTTCACGATTGTTTTGTCAAC
GTAAGTTCATTATTTTTTGTCTTTATA
GTTCTCATTGATCTTTAGTTTGTTTGAATCATATACGATGTATTGAGAAGGTTTCGTGTATGTTTTGATAATAAATGGTTAGGGTTGTGATGGATCGGTCTTGTTGGATGATACTGCCAC
CTTCACCGGAGAAAAGACTGCATTTCCTAATGCTAACTCGATTAGAGGATTTGATGTTGTGGATCAAATTAAGACACAAGTGAATAAAGTTTGTAAAGAAAATGTCGTGTCTTGTGCTGA
CATCTTAGCTGTTGCTGCTCGTGACTCCGTTGCTATT
GTAAGTTTTGGCTTCTTCTCCAAAAACATTTATAACTAATTATTAAATTGACTCAGTTATTGACCATTTGTGTTTCAGCTAGG
AGGGCCAAACTACAAGGTACTAGTAGGAAGAAGAGACGCGAGAACAGCGAGTGCAAACGATGCCAACAGAAATCTCCCTCCACCATTTTTCAGCTTCAGTCAACTTCTTTCCAACTTCCA
ATCTCATGGCCTTGAACTCAAGGACCTCGTCCTATTGTCAGCTGGCCACACTCTAGGGCTAGCTCGGTGCACTAGTTTTCGAAGTAGGATATACAATGACACGAACATTGATTCAAAATT
TGCAACAACGTTGCAAAAGAACTGCCCACAGAGTGGTGGGGATGACAACTTGAAAGGTCTTGACAAGAGTCCAAACTTCTTTGACAATGCCTACTTCAAGGCTTTGTTGACAAACAAGGG
ACTTCTTCATTCTGACCAAGAACTGTTTGGCGGTGGCAACAACGATAGCGATGATTTGGTGAAGTATTATAGTAGATATCCAAATGACTTTAAAAAGGACTTTGGTTCTTCTATGATTAA
GATGGGGAATATGAATCCACTTACAGGAACTAATGGAGAAATCAGAACTAACTGTAGGTTTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCATTATCCACTCTCTTTTGCTTTGTTTTATTGTTTTATCAGCTTCCCTAAGCCATACCCATGCACAACTAACTCCAAACTTTTACAACAACGTCTGCCCAAGGGCCTTGTCC
ACCATTAAATCCGTCGTTTCGAAGGCCATCAGGCGCGAGCCTCGAATGGGTGCTTCGCTATTACGTCTCCATTTTCACGATTGTTTTGTCAAC
GGTTGTGATGGATCGGTCTTGTTGGAT
GATACTGCCACCTTCACCGGAGAAAAGACTGCATTTCCTAATGCTAACTCGATTAGAGGATTTGATGTTGTGGATCAAATTAAGACACAAGTGAATAAAGTTTGTAAAGAAAATGTCGTG
TCTTGTGCTGACATCTTAGCTGTTGCTGCTCGTGACTCCGTTGCTATT
CTAGGAGGGCCAAACTACAAGGTACTAGTAGGAAGAAGAGACGCGAGAACAGCGAGTGCAAACGATGCCAAC
AGAAATCTCCCTCCACCATTTTTCAGCTTCAGTCAACTTCTTTCCAACTTCCAATCTCATGGCCTTGAACTCAAGGACCTCGTCCTATTGTCAGCTGGCCACACTCTAGGGCTAGCTCGG
TGCACTAGTTTTCGAAGTAGGATATACAATGACACGAACATTGATTCAAAATTTGCAACAACGTTGCAAAAGAACTGCCCACAGAGTGGTGGGGATGACAACTTGAAAGGTCTTGACAAG
AGTCCAAACTTCTTTGACAATGCCTACTTCAAGGCTTTGTTGACAAACAAGGGACTTCTTCATTCTGACCAAGAACTGTTTGGCGGTGGCAACAACGATAGCGATGATTTGGTGAAGTAT
TATAGTAGATATCCAAATGACTTTAAAAAGGACTTTGGTTCTTCTATGATTAAGATGGGGAATATGAATCCACTTACAGGAACTAATGGAGAAATCAGAACTAACTGTAGGTTTGTTAAT
TAA

Retrieve as FASTA