Entry information : CsaPrx103 (Cucsa.393950.1)
Entry ID 8802
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: CsaPrx103 (Cucsa.393950.1)
Name (synonym) CsaPrx103 (Cucsa.393950.1)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx103
start..stop
S start..stop
MePrx114 511 0 20..316 23..319
CpapPrx26 507 0 4..317 10..322
CsPrx27 506 0 8..316 9..316
RcPrx74 504 0 22..316 22..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 60024..60227 204 N° 2 60334..60522 189 N° 3 60620..60782 163 N° 4 60900..61297 398
join(60024..60227,60334..60522,60620..60782,60900..61297)


exon

Literature and cross-references CsaPrx103 (Cucsa.393950.1)
DNA ref. Phytozome 12:   scaffold04100 (60024..61297)
Protein sequence: CsaPrx103 (Cucsa.393950.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (295)
PWM (Da):   %s   34505.6 (32003.2)  
PI (pH):   %s   8.92 (8.92) Peptide Signal:   %s   cut: 23 range:23-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSLFFTFLLLFFSLLLPSLNALSHHYYDHTCPNLESIVAREVRLATANDKTVPAALLRMHFHDCFIRGCDGSVLLDSKGKNTAEKDGPPNISLHAFYVIDNAKKAIESTCPGVVSCADILALAARDAVVVSGGPHWEVPKGRKDGRISKASETRQLPAPTFNFSQLQQSFSQRGLSLHDLVALSGGHTLGFAHCSSFQNRIHNFNSSLDVDPSLDSSFAASLRRVCPARNKVKNAGSTMDSSSTVFDNAYYKLLLEGKSIFSSDQSLLSTPKTKALVSKFANEQHLFEKAFVKSMVKMSQIAGAGQEVRLNCRLIR

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTAGTCTCTTCTTCACCTTTCTTCTCCTCTTTTTTTCCTTGCTTCTTCCTTCTCTCAATGCCTTGAGCCACCATTACTATGACCACACATGCCCTAATCTCGAGTCCATCGTCGCT
CGAGAAGTTCGCTTAGCCACTGCAAACGACAAGACCGTTCCTGCTGCGTTGCTGAGAATGCACTTCCATGATTGTTTCATCAGA
GTAAAAACCAAATCATTATAAACAAAGCAATACTCT
ATAGAGTTCGTTTAGAATGGCTTTGTAATAAGTATTGACTATGAAATGTTTGTTTTTTTTGTTTTTGAAGGGTTGCGATGGTTCTGTACTTCTCGACTCCAAGGGGAAGAACACGGCTGA
AAAAGATGGCCCTCCTAATATCTCTCTCCATGCTTTTTATGTCATTGACAATGCCAAGAAAGCAATTGAATCTACTTGTCCGGGCGTAGTTTCTTGTGCTGATATCTTAGCTCTTGCTGC
TCGAGATGCTGTTGTTGTG
GTAATTATATTATTCTAATCAAATTATTGAGAATCGTTTTAAAATAATTCTTTAATTTGAATGAATGATTTTTACCTTTGAAAACATGTTGTGTCAGTCGG
GAGGTCCTCACTGGGAAGTCCCAAAAGGAAGAAAAGATGGAAGAATCTCAAAAGCTAGTGAAACAAGACAATTACCAGCTCCCACATTCAACTTCTCTCAACTCCAACAAAGCTTCTCCC
AGAGAGGCCTTTCTTTACATGATCTTGTCGCTCTTTCAG
GTTGATCGTCGTCGTTATCCTGCCATCATGTTTAAATTACCGCTAAACTCAATCATTCAGTTTGTTTTAATTAAAATCTTA
AGTAGTTGATAAACTAAAAATGTATTTAAATTTCAGGAGGCCACACTCTTGGATTTGCCCATTGCTCGTCATTTCAAAACCGAATCCACAACTTCAACTCGAGCCTCGATGTCGACCCAT
CATTGGATTCAAGCTTTGCAGCCAGTCTACGTAGGGTATGTCCAGCGAGAAACAAGGTGAAAAACGCAGGGTCAACCATGGATTCGAGTTCAACAGTATTTGACAATGCATATTACAAGC
TTCTTCTTGAAGGGAAGAGCATATTTTCATCAGATCAATCTTTGCTTTCAACACCAAAAACAAAGGCTTTGGTTTCAAAATTTGCCAACGAACAACATCTGTTTGAGAAAGCTTTTGTTA
AGTCCATGGTGAAGATGAGTCAGATAGCCGGCGCCGGGCAAGAGGTTCGGCTGAACTGCAGGCTGATCAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTAGTCTCTTCTTCACCTTTCTTCTCCTCTTTTTTTCCTTGCTTCTTCCTTCTCTCAATGCCTTGAGCCACCATTACTATGACCACACATGCCCTAATCTCGAGTCCATCGTCGCT
CGAGAAGTTCGCTTAGCCACTGCAAACGACAAGACCGTTCCTGCTGCGTTGCTGAGAATGCACTTCCATGATTGTTTCATCAGA
GGTTGCGATGGTTCTGTACTTCTCGACTCCAAGGGG
AAGAACACGGCTGAAAAAGATGGCCCTCCTAATATCTCTCTCCATGCTTTTTATGTCATTGACAATGCCAAGAAAGCAATTGAATCTACTTGTCCGGGCGTAGTTTCTTGTGCTGATATC
TTAGCTCTTGCTGCTCGAGATGCTGTTGTTGTG
TCGGGAGGTCCTCACTGGGAAGTCCCAAAAGGAAGAAAAGATGGAAGAATCTCAAAAGCTAGTGAAACAAGACAATTACCAGCTCCC
ACATTCAACTTCTCTCAACTCCAACAAAGCTTCTCCCAGAGAGGCCTTTCTTTACATGATCTTGTCGCTCTTTCAG
GAGGCCACACTCTTGGATTTGCCCATTGCTCGTCATTTCAAAAC
CGAATCCACAACTTCAACTCGAGCCTCGATGTCGACCCATCATTGGATTCAAGCTTTGCAGCCAGTCTACGTAGGGTATGTCCAGCGAGAAACAAGGTGAAAAACGCAGGGTCAACCATG
GATTCGAGTTCAACAGTATTTGACAATGCATATTACAAGCTTCTTCTTGAAGGGAAGAGCATATTTTCATCAGATCAATCTTTGCTTTCAACACCAAAAACAAAGGCTTTGGTTTCAAAA
TTTGCCAACGAACAACATCTGTTTGAGAAAGCTTTTGTTAAGTCCATGGTGAAGATGAGTCAGATAGCCGGCGCCGGGCAAGAGGTTCGGCTGAACTGCAGGCTGATCAGATGA

Retrieve as FASTA