Entry information : CsaPrx12 (Cucsa.000260.1)
Entry ID 8806
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2014-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-03-28 (Christophe Dunand)
Peroxidase information: CsaPrx12 (Cucsa.000260.1)
Name (synonym) CsaPrx12 (Cucsa.000260.1)
Class Class III peroxidase    [Orthogroup: Prx054]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx12
start..stop
S start..stop
CsaPrx13 543 0 14..315 12..313
CsaPrx14 460 9e-165 14..315 23..325
CclPrx07 441 3e-157 5..315 10..323
CsPrx15 441 3e-157 5..315 10..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38742..38945 204 N° 2 39091..39294 204 N° 3 39426..39577 152 N° 4 39796..40180 385
join(38742..38945,39091..39294,39426..39577,39796..40180)


exon

Literature and cross-references CsaPrx12 (Cucsa.000260.1)
DNA ref. Phytozome 12:   scaffold00009 (38742..40180)
Protein sequence: CsaPrx12 (Cucsa.000260.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (295)
PWM (Da):   %s   34244.56 (32139.5)  
PI (pH):   %s   9.48 (9.48) Peptide Signal:   %s   cut: 21 range:21-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSTMALALVLLAVLMGTSSAHLSPNFYHNTCPNLLSLVRAGVRSAVAKEARMGASLLRLHFHDCFVNGCDGSILLDDTPTFLGEQTAAPNNRSVRGFNVIASIKEKIEKNCPGVVSCADILTLSARDSVVALGGPSWKVKLGRRDSKTASFSDVTGAIPPPTSTLATLINRFNTKGLSPKDLVALSGAHTIGKARCLFFKNRIYNETNIDKSFAKKRQRNCPRNGGDDNRTPFDFRTPNLFDNNYYKNLLEKKALLRSDQVLHNGGSTDSLVELYSHDSAAFESDFVAAMIKMGDIEPLTGLQGEIRKVCSRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (5' end is missing and partial prediction of intron 3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGTCGACTATGGCTTTAGCATTAGTCTTATTGGCAGTACTCATGGGAACCTCCTCAGCTCATCTTTCTCCCAACTTCTACCACAACACTTGTCCTAACCTCCTTAGCCTAGTTCGA
GCTGGTGTTCGGTCTGCTGTTGCTAAGGAAGCTCGCATGGGTGCTTCCCTTCTCCGTCTCCACTTTCACGATTGTTTCGTCAAT
GTACGGAAACCTTTCTTTTCTTTTCTTCTATTATTT
ATTCATCACACTTTTCTAAACTCTACAAAAATAAAACTGTTGTGTCATGTGTTCTCTAGCTACTTTTCGCTTTTTCTAATTTTAGTATTGCAAATCATAATTTACCCAGGGTTGCGATGG
ATCGATCCTTCTAGATGATACTCCTACATTTTTAGGAGAGCAAACAGCAGCTCCTAACAATAGATCTGTTAGAGGGTTCAATGTGATTGCCAGTATAAAGGAGAAGATAGAAAAAAATTG
TCCTGGTGTTGTCTCTTGTGCTGATATTTTGACTTTATCTGCTCGTGACTCTGTTGTAGCAGTGAGTTATTTT
GTTTAATGTTTATTAAAATTGTTTGTTGCAATCTTATTTTGGTTTAA
TTTGAATATCATGATGATCGTATCAATTTTTTTCCTTTGTTAATTATTGTTTTAAAAAAAAACCTCTTAGTTGGGAGGGCCAAGTTGGAAAGTGAAATTGGGAAGGAGAGATTCCAAAAC
AGCCAGCTTCTCCGATGTCACTGGTGCCATTCCTCCACCGACCTCCACCCTTGCCACTCTCATCAATCGGTTCAATACCAAAGGCCTTTCCCCAAAGGATTTGGTTGCTTTATCTG
GTAT
ATATTTCCATCGATCGTTTTCTTCGATTTAAAAGTTTTCATTCTCACTAAAATAATAAGAAGACCAAAGATTATATAATGTGCCTGCATCACTAAAAACTATTGGATGAATATGTATATA
CTTTGAATACTAGCTAAACTCACAAATTTTAGTGGTTTCTTCTCAAGTAAATTTCAAATTTTTAGGAGATAATGGTTTGTGTCATGCATGCAAGTGCTCACACAATTGGAAAAGCAAGAT
GTTTGTTTTTCAAGAATCGTATTTACAATGAAACCAATATCGACAAGTCATTTGCTAAGAAAAGACAAAGGAATTGTCCAAGAAATGGAGGAGACGATAACCGTACTCCTTTTGACTTCA
GAACCCCAAACCTTTTCGATAACAATTACTACAAGAATCTTTTGGAGAAAAAGGCTTTGCTCCGCTCTGATCAAGTGCTACACAATGGTGGATCCACCGATTCTTTAGTTGAACTCTACA
GTCATGACAGTGCAGCTTTTGAATCCGACTTCGTGGCAGCTATGATCAAAATGGGTGACATTGAACCACTCACTGGATTGCAAGGCGAGATCCGCAAAGTCTGTAGTCGACCCAACTAA

Retrieve as FASTA