Entry information : CsaPrx15 (Cucsa.043200.1)
Entry ID 8809
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaPrx15 (Cucsa.043200.1)
Name (synonym) CsaPrx15 (Cucsa.043200.1)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx15
start..stop
S start..stop
PbPrx02 535 0 1..332 1..333
PtPrx45 532 0 1..332 1..333
RcPrx17 531 0 1..331 1..330
CclPrx35 531 0 1..331 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 97983..98213 231 N° 2 98315..98506 192 N° 3 98595..98760 166 N° 4 98840..99249 410
join(97983..98213,98315..98506,98595..98760,98840..99249)


exon

Literature and cross-references CsaPrx15 (Cucsa.043200.1)
DNA ref. Phytozome 12:   scaffold00542 (97983..99249)
Protein sequence: CsaPrx15 (Cucsa.043200.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (310)
PWM (Da):   %s   36364.33 (33904.0)  
PI (pH):   %s   8.97 (9.06) Peptide Signal:   %s   cut: 23 range:23-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKLLSFVLVLSLLAFAPLCLCSRNNGGFGSLYPQYYDRSCPKAKEIVKSIVAKAFAREARIAASILRLHFHDCFVQGCDASLLLDSSGNIRSEKNSNPNKNSARGFEVIDEIKSALEKECPQTVSCADILSLAARDSTFITGGPYWEVPLGRKDSRTASLSGSNNNIPAPNNTFQTILNRFQNQGLDIVDLVALSGGHTIGNSRCTSFRQRLYNQNGNGQPDKTLPQSFATDLRSRCPRSGGDNNLFSLDYSPTKFDNSYFKNLVAFKGLLNSDQVLLTGNDASAALVKKYADDSEEFFQQFAKSMIKMSNISPLTGSSGEIRKTCRKINN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGCTTTTAAGCTTTGTTCTTGTTCTTTCCCTTCTTGCCTTTGCTCCACTCTGTTTGTGTAGCAGAAATAATGGTGGCTTTGGCTCTCTATACCCACAATATTATGACCGTTCC
TGCCCCAAAGCTAAAGAAATAGTAAAATCCATTGTGGCTAAGGCTTTTGCCAGAGAAGCTCGTATTGCTGCTTCTATCCTTAGACTTCACTTCCATGACTGTTTTGTTCAG
GTCAACTTT
ACTAGTCTTCCTTTGTCCTTTTTGACTTTGTGTTTCTTAAATAAATTTATTGTTCAAGTTATTCACACGTTTTGAGTTAATTGGTGATTTAGGGATGTGATGCATCTCTACTTTTGGATA
GTAGTGGAAACATTAGGAGCGAGAAGAATTCAAACCCGAATAAGAACTCGGCCAGAGGATTTGAGGTGATTGATGAGATCAAATCTGCATTGGAGAAAGAGTGCCCACAAACTGTTTCTT
GTGCTGATATCTTGTCTTTGGCTGCAAGAGATTCGACGTTCATT
GTACGTGTTTGTCATCGTAATATATATTTTTATTGTGTTTTGAATGGTTAAATCATTATGAGCTTGAAGTTTATTT
ATATAATGACAGACGGGCGGACCATATTGGGAGGTTCCATTAGGAAGGAAGGACTCAAGAACAGCAAGTTTGAGTGGATCCAACAATAACATTCCCGCTCCAAACAATACTTTCCAAACC
ATTCTCAATAGATTCCAAAACCAAGGGCTTGACATTGTTGATCTTGTTGCCTTATCAG
GTAACATTTTTAGCTTCTTTCACATCCTTTAACGAACAAGTCAATATTCACACACATGATCG
TCCTGTTTTGTATACAGGAGGCCACACCATCGGAAATTCAAGGTGCACCAGCTTCAGGCAGAGGTTATACAACCAAAACGGCAACGGACAACCCGACAAAACCCTTCCTCAGTCGTTCGC
GACGGACCTCCGTAGCCGTTGCCCGAGATCCGGCGGCGACAATAACCTCTTTTCCCTGGACTACAGCCCGACCAAATTCGACAACAGCTATTTTAAGAACCTGGTTGCTTTCAAAGGGCT
TCTCAACTCCGACCAAGTTCTCCTCACCGGAAACGACGCGTCGGCCGCTTTGGTTAAGAAATATGCAGACGACAGCGAGGAGTTCTTCCAGCAATTCGCCAAATCTATGATCAAAATGAG
TAATATTTCCCCATTGACGGGTTCAAGTGGAGAGATCAGAAAGACTTGCAGGAAGATCAACAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGCTTTTAAGCTTTGTTCTTGTTCTTTCCCTTCTTGCCTTTGCTCCACTCTGTTTGTGTAGCAGAAATAATGGTGGCTTTGGCTCTCTATACCCACAATATTATGACCGTTCC
TGCCCCAAAGCTAAAGAAATAGTAAAATCCATTGTGGCTAAGGCTTTTGCCAGAGAAGCTCGTATTGCTGCTTCTATCCTTAGACTTCACTTCCATGACTGTTTTGTTCAG
GGATGTGAT
GCATCTCTACTTTTGGATAGTAGTGGAAACATTAGGAGCGAGAAGAATTCAAACCCGAATAAGAACTCGGCCAGAGGATTTGAGGTGATTGATGAGATCAAATCTGCATTGGAGAAAGAG
TGCCCACAAACTGTTTCTTGTGCTGATATCTTGTCTTTGGCTGCAAGAGATTCGACGTTCATT
ACGGGCGGACCATATTGGGAGGTTCCATTAGGAAGGAAGGACTCAAGAACAGCAAGT
TTGAGTGGATCCAACAATAACATTCCCGCTCCAAACAATACTTTCCAAACCATTCTCAATAGATTCCAAAACCAAGGGCTTGACATTGTTGATCTTGTTGCCTTATCAG
GAGGCCACACC
ATCGGAAATTCAAGGTGCACCAGCTTCAGGCAGAGGTTATACAACCAAAACGGCAACGGACAACCCGACAAAACCCTTCCTCAGTCGTTCGCGACGGACCTCCGTAGCCGTTGCCCGAGA
TCCGGCGGCGACAATAACCTCTTTTCCCTGGACTACAGCCCGACCAAATTCGACAACAGCTATTTTAAGAACCTGGTTGCTTTCAAAGGGCTTCTCAACTCCGACCAAGTTCTCCTCACC
GGAAACGACGCGTCGGCCGCTTTGGTTAAGAAATATGCAGACGACAGCGAGGAGTTCTTCCAGCAATTCGCCAAATCTATGATCAAAATGAGTAATATTTCCCCATTGACGGGTTCAAGT
GGAGAGATCAGAAAGACTTGCAGGAAGATCAACAATTAG

Retrieve as FASTA