Entry information : CsaPrx22 (Cucsa.085290.1)
Entry ID 8812
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-11 (Christophe Dunand)
Peroxidase information: CsaPrx22 (Cucsa.085290.1)
Name (synonym) CsaPrx22 (Cucsa.085290.1)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx22
start..stop
S start..stop
PpePrx08 418 8e-148 25..330 29..332
CpapPrx45 412 2e-145 22..330 29..342
RcPrx31 409 5e-144 5..330 11..335
MePrx117 407 2e-143 25..330 29..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 170572..170793 222 N° 2 170208..170399 192 N° 3 169061..169226 166 N° 4 168541..168965 425
complement(join(168541..168965,169061..169226,170208..170399,170572..170793))


exon

Literature and cross-references CsaPrx22 (Cucsa.085290.1)
DNA ref. Phytozome 12:   scaffold00867 (170793..168541)
Protein sequence: CsaPrx22 (Cucsa.085290.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (310)
PWM (Da):   %s   36979.35 (33972.8) Transmb domain:   %s   i7-26o
PI (pH):   %s   4.76 (4.74) Peptide Signal:   %s   cut: 26 range:26-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPPNTPIFLSFFFLIFIFFFEPSRAYIELRPDFYDESCPRLPMIIRYHIWAAVQNDSRMAASLLRLNFHDCIVDGCDASVLLDDTTEMKGEKNAPGNVKSLRGFEVIDGIKADLEAYCPQTVSCADIVNLAAREAVYLVGGPFWHLPLGRRDGLTASIKSVLAQLPSPKASLENNTAKFISKGLDLKDLVVLSGAHTIGFARCVTFKGRLFNFKGSGNPDPDINAAMLTDLRSMCPNRNDGTGANLAPLDVASYDRFDNEYFTNLIGNVGLLESDQGLMADPQTGRMVREYSFDPNLFFEDFAESMFRMSLVGVMTGREGQIRKQCGVVNNDDG

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCCCAACACTCCCATTTTCCTCTCTTTTTTCTTCCTAATTTTTATCTTCTTCTTTGAACCATCTAGGGCTTACATCGAGCTTAGACCTGACTTTTACGATGAGTCGTGCCCCCGT
TTGCCGATGATAATTCGGTATCATATTTGGGCTGCTGTCCAAAATGACTCTAGAATGGCTGCCTCACTGTTGCGGTTGAACTTCCACGACTGCATTGTAGAC
GTATGTAAACTGCATCAT
TTGCATATTGTTTAATACTATTACAATCATTTATTTAGTTGGTCTAAATGCTCGAACATATATATATTTTGATTTTGAAAGAGAATGCTCGAACATATTAGAAAGAGAAACAGAAGTTTT
ATCTTTTTCTTTTCTTCTATATTGTGTGTTTTAGGGATGTGATGCATCGGTACTACTTGATGATACAACAGAAATGAAAGGTGAGAAAAATGCGCCAGGTAACGTGAAATCGCTTCGAGG
ATTTGAAGTGATTGATGGAATAAAAGCAGACCTAGAAGCATATTGCCCACAGACAGTTTCATGTGCTGATATTGTGAATCTTGCAGCCAGAGAAGCTGTGTATTTG
GTACTTTTCTTTTA
ACATTTTCCTATATTGAGTAAACTTAAAATCATCATTTGGTATATTACTTCTAAGTGAATTGCTAACAAGAAACGTTTCTAACATCTATTATAGTTAATTATGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTAAGCTTGAAAAGATTTTTTCAGTTTTCGAAATATATCCTGCGATTGAGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATTAGTGTGGTTATAACNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGATCTCGAATCAATTATATGTTCTACGTGCATTTTTTTTAGTTAAATCCTTCCGAACTTTTAATAACAGGACTTTCATTACAATTTATAAAATACA
CGAACTAAATAGCTACTAAGAGGATGTTTGGAGTAACCTTATTATAGTTTTAGGTTATTTGAATTAAACTAAATAGCTACTGACTAAGAGGATGTTTAGAGTAACGAGTAAGATCCTAAA
ATTTTAAGAGCACAAAGATTAAATTATTATCGAGGTTGGAACTAAAGAGTTAATTCTATTAAAAGTTAACGAGGGTAGAGGTGCTTTTTTAAACCTAAAATCATCAGTCCATATGATAAA
TAATTGGTCGGTAATCATGGTCTTTATAATCATCTTGGAGGTAATAGGATTGATTTTCAAAGCGTTTAAAGCAAAATTTAACCTTAGAAGTATGCTTTTGCTAATTTGAAACATGAATTT
GGATTAGGTTGGAGGGCCATTTTGGCACCTTCCACTGGGACGTAGAGATGGTTTAACCGCAAGCATAAAATCAGTGCTGGCTCAGCTCCCATCTCCCAAGGCATCTCTAGAGAACAACAC
CGCCAAGTTCATCTCAAAAGGTCTGGACTTAAAGGATCTCGTCGTGCTTTCAG
GTCAGTAACACAAACAAAACCCATTTGTATTTCTTTTATGTTTTTCTTCTCTTGGACATTTCATTGA
AAACACCTTCCCATGCGCCACCAAACAGGAGCCCACACCATCGGCTTCGCCCGCTGCGTAACATTCAAAGGCCGTCTCTTCAACTTCAAAGGCTCCGGGAACCCAGATCCTGACATAAAC
GCCGCAATGCTCACCGACCTCCGGTCCATGTGCCCCAACAGGAACGACGGCACCGGCGCCAATTTGGCGCCGCTGGATGTGGCCAGTTACGACAGGTTCGACAACGAGTATTTTACCAAT
CTGATTGGCAATGTTGGGCTTTTAGAGTCGGATCAGGGTCTGATGGCGGACCCCCAGACGGGGAGAATGGTTAGAGAATACAGTTTTGATCCGAATCTGTTCTTCGAGGACTTTGCAGAG
TCGATGTTCAGGATGAGTTTGGTTGGGGTAATGACTGGCCGTGAAGGGCAGATTCGAAAGCAATGTGGCGTTGTTAATAATGATGATGGTTAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCCCAACACTCCCATTTTCCTCTCTTTTTTCTTCCTAATTTTTATCTTCTTCTTTGAACCATCTAGGGCTTACATCGAGCTTAGACCTGACTTTTACGATGAGTCGTGCCCCCGT
TTGCCGATGATAATTCGGTATCATATTTGGGCTGCTGTCCAAAATGACTCTAGAATGGCTGCCTCACTGTTGCGGTTGAACTTCCACGACTGCATTGTAGAC
GGATGTGATGCATCGGTA
CTACTTGATGATACAACAGAAATGAAAGGTGAGAAAAATGCGCCAGGTAACGTGAAATCGCTTCGAGGATTTGAAGTGATTGATGGAATAAAAGCAGACCTAGAAGCATATTGCCCACAG
ACAGTTTCATGTGCTGATATTGTGAATCTTGCAGCCAGAGAAGCTGTGTATTTG
GTTGGAGGGCCATTTTGGCACCTTCCACTGGGACGTAGAGATGGTTTAACCGCAAGCATAAAATCA
GTGCTGGCTCAGCTCCCATCTCCCAAGGCATCTCTAGAGAACAACACCGCCAAGTTCATCTCAAAAGGTCTGGACTTAAAGGATCTCGTCGTGCTTTCAG
GAGCCCACACCATCGGCTTC
GCCCGCTGCGTAACATTCAAAGGCCGTCTCTTCAACTTCAAAGGCTCCGGGAACCCAGATCCTGACATAAACGCCGCAATGCTCACCGACCTCCGGTCCATGTGCCCCAACAGGAACGAC
GGCACCGGCGCCAATTTGGCGCCGCTGGATGTGGCCAGTTACGACAGGTTCGACAACGAGTATTTTACCAATCTGATTGGCAATGTTGGGCTTTTAGAGTCGGATCAGGGTCTGATGGCG
GACCCCCAGACGGGGAGAATGGTTAGAGAATACAGTTTTGATCCGAATCTGTTCTTCGAGGACTTTGCAGAGTCGATGTTCAGGATGAGTTTGGTTGGGGTAATGACTGGCCGTGAAGGG
CAGATTCGAAAGCAATGTGGCGTTGTTAATAATGATGATGGTTAT

Retrieve as FASTA