Entry information : CsaPrx30 (Cucsa.098230.1)
Entry ID 8818
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-01-09 (Qiang Li)
Peroxidase information: CsaPrx30 (Cucsa.098230.1)
Name (synonym) CsaPrx30 (Cucsa.098230.1)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx30
start..stop
S start..stop
VvPrx25 491 7e-177 21..332 16..327
RcPrx66 475 2e-170 24..332 19..327
PpePrx35 471 7e-169 17..331 14..325
PpePrx64 469 4e-168 1..331 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 316629..317031 403 N° 2 315581..316176 596  
complement(join(315581..316176,316629..317031))


exon

Literature and cross-references CsaPrx30 (Cucsa.098230.1)
DNA ref. Phytozome 12:   scaffold00923 (317031..315527)
Protein sequence: CsaPrx30 (Cucsa.098230.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (307)
PWM (Da):   %s   36777.47 (33952.9)  
PI (pH):   %s   6.84 (6.78) Peptide Signal:   %s   cut: 26 range:26-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFPFPFPLLFLVTIILPFPSLVHSKLSLGYYQKTCPDFEKIIRETVTNKQITSPVTAAGTLRLFFHDCMVDGCDASVLISSNSFNQAEREAEINHSLSGDAFDVVVHAKTNLELACPGIVSCSDILAQATRDLVVMVGGPFYNVRLGRKDGMISKAGNVEGNLPTVNFTMDKLIDYFVERGFTVQELVALSGGHTIGFSHCKEFTDRLFHHSPTSPTDPDIYPKFAEKLKTMCANYEKDTAMSAFNDVITPGKFDNMFYQNLPRGLGLLATDNALDKDPRTKPFVDLYAVNQTAFFHDFGRAMEKLSVHGVKTGRKGEVRRRCDLFNSINT

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCCCTTTCCCTTTCCCTTTACTTTTCCTCGTTACCATCATCCTCCCTTTCCCATCTCTTGTTCATTCCAAACTCTCCCTCGGTTATTACCAAAAAACATGTCCCGACTTTGAG
AAGATTATTCGTGAAACTGTCACCAATAAACAAATAACCAGTCCTGTTACCGCTGCAGGAACCCTTCGCCTCTTCTTCCATGACTGTATGGTTGATGGTTGTGATGCCTCCGTTCTCATT
TCCTCCAACTCCTTCAACCAAGCTGAGCGTGAGGCTGAAATCAACCACTCCCTTTCTGGTGACGCCTTCGATGTCGTCGTCCATGCTAAGACCAACCTCGAACTCGCATGCCCTGGCATT
GTGTCTTGTTCTGACATCTTGGCACAGGTCAATCAATCATCAT
AGTTTTCTTAATATATTAACCTTCTAGCTACGCCTTAATTTTCTTTTTCTTACGTATCATATCATTTCAAAGTTATA
ATATTTCCCATCACACCTCTTTCAAAATTATCATTAATAATAAATAGTGTAAATGATATGAATTGTTTTCACTAAAACATACATCAGGCAATCTTTTATTAGTTTTTTTTAGGCAACAAT
CTTTTCTAAAAGTAACGATATAGACAATGGTTAGAACATGAAATAATGTAGAAAATGAAAATTGGATCCGCACAACACTACATTCGTTCTCATCGCTTAATTATTGTATAAGATAGATTT
GGGTGTTGCATGCATCTATGATCTTTTTATTATTGTTATTAGTCTAACAGTATGATCAACCATTGATAGCAGTTATCTAAAAACTAACACAATTGGAATAATGAATGACAAATAATTAGG
CGACTCGAGATCTAGTAGTGATGGTGGGAGGACCATTCTACAACGTTCGATTGGGGAGAAAAGACGGAATGATATCAAAAGCAGGCAATGTGGAAGGGAACCTCCCAACAGTGAACTTCA
CAATGGACAAACTCATCGATTACTTCGTTGAAAGAGGCTTCACCGTCCAAGAACTGGTCGCCCTCTCCGGCGGTCACACCATCGGTTTCTCCCACTGCAAGGAATTCACCGACCGACTCT
TCCACCATAGTCCCACGTCACCCACCGACCCAGACATATACCCAAAATTCGCCGAAAAGCTAAAGACCATGTGTGCCAATTACGAAAAAGACACCGCCATGTCAGCTTTCAACGACGTCA
TAACACCTGGCAAATTCGACAATATGTTCTACCAGAATCTTCCACGTGGCCTAGGCCTACTGGCCACTGACAACGCCCTCGATAAGGATCCAAGGACGAAGCCCTTTGTGGATCTTTACG
CTGTTAACCAAACGGCGTTTTTTCACGACTTTGGTCGCGCTATGGAGAAGCTCAGTGTTCACGGCGTTAAAACGGGAAGAAAGGGGGAGGTTCGACGAAGGTGTGACCTTTTTAATTCTA
TTAATACATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCCCTTTCCCTTTCCCTTTACTTTTCCTCGTTACCATCATCCTCCCTTTCCCATCTCTTGTTCATTCCAAACTCTCCCTCGGTTATTACCAAAAAACATGTCCCGACTTTGAG
AAGATTATTCGTGAAACTGTCACCAATAAACAAATAACCAGTCCTGTTACCGCTGCAGGAACCCTTCGCCTCTTCTTCCATGACTGTATGGTTGATGGTTGTGATGCCTCCGTTCTCATT
TCCTCCAACTCCTTCAACCAAGCTGAGCGTGAGGCTGAAATCAACCACTCCCTTTCTGGTGACGCCTTCGATGTCGTCGTCCATGCTAAGACCAACCTCGAACTCGCATGCCCTGGCATT
GTGTCTTGTTCTGACATCTTGGCACAGGTCAATCAATCATCAT
TAGTGATGGTGGGAGGACCATTCTACAACGTTCGATTGGGGAGAAAAGACGGAATGATATCAAAAGCAGGCAATGTG
GAAGGGAACCTCCCAACAGTGAACTTCACAATGGACAAACTCATCGATTACTTCGTTGAAAGAGGCTTCACCGTCCAAGAACTGGTCGCCCTCTCCGGCGGTCACACCATCGGTTTCTCC
CACTGCAAGGAATTCACCGACCGACTCTTCCACCATAGTCCCACGTCACCCACCGACCCAGACATATACCCAAAATTCGCCGAAAAGCTAAAGACCATGTGTGCCAATTACGAAAAAGAC
ACCGCCATGTCAGCTTTCAACGACGTCATAACACCTGGCAAATTCGACAATATGTTCTACCAGAATCTTCCACGTGGCCTAGGCCTACTGGCCACTGACAACGCCCTCGATAAGGATCCA
AGGACGAAGCCCTTTGTGGATCTTTACGCTGTTAACCAAACGGCGTTTTTTCACGACTTTGGTCGCGCTATGGAGAAGCTCAGTGTTCACGGCGTTAAAACGGGAAGAAAGGGGGAGGTT
CGACGAAGGTGTGACCTTTTTAATTCTATTAATACATGA

Retrieve as FASTA