Entry information : CsaPrx31 ( Cucsa.102290.1/ peroxidase 10)
Entry ID 8819
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2016-01-15 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-15 (Achraf Jemmat)
Peroxidase information: CsaPrx31 ( Cucsa.102290.1/ peroxidase 10)
Name (synonym) CsaPrx31 ( Cucsa.102290.1/ peroxidase 10)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx31
start..stop
S start..stop
CclPrx59 480 2e-172 4..327 6..329
CsPrx09 477 2e-171 22..327 5..310
NtPrx31-1A 474 7e-170 13..327 13..327
NtPrx31-1B 471 1e-168 16..327 16..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1321779..1321996 218 N° 2 1322321..1322512 192 N° 3 1322593..1322755 163 N° 4 1322837..1323247 411
join(1321779..1321996,1322321..1322512,1322593..1322755,1322837..1323247)


exon

Literature and cross-references CsaPrx31 ( Cucsa.102290.1/ peroxidase 10)
DNA ref. GenBank:   NC_026660.1 (23301458..23302926) Phytozome 12:   scaffold00927 (1321779..1323243)
Cluster/Prediction ref. Genebank:   101218459
Protein sequence: CsaPrx31 ( Cucsa.102290.1/ peroxidase 10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327
PWM (Da):   %s   36519.17 Transmb domain:   %s   i7-24o
PI (pH):   %s   6.88
Sequence 368
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKDNSSKYVVVLVISFFFLNQVLVSSQLDYRFYDASCPNLTRIVRYGVWMAVSNDTRMAASLLRLHFHDCFVNGCDGSLLLDDTNTFKGEKNALPNVNSVRGYEVIDNIKAVLEKFCPSVVSCTDIVTLAAREAVYLAGGPFWQIPLGRRDGTTASESEANQLPSPVEPLEDIIAKFTSKGFNVKDVVALSGAHTFGFARCMMFKHRLFNFDGAGNPDPELDVMLRQNLQNNCPNQDDSNNKFAPLDAYTINRFDNVYYRNLVNKLGLLQSDQDLMKDNTTASLVVSYSRYPYMFYRDFGASMVKLANTGILTGQNGEIRKNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAAGATAACTCCTCCAAATATGTTGTTGTTTTGGTTATAAGCTTCTTTTTCTTGAATCAGGTCCTTGTGTCCTCACAACTTGATTATAGGTTCTACGATGCCTCTTGTCCCAATCTAA
CAAGGATTGTCAGATATGGCGTCTGGATGGCAGTTTCTAATGATACTAGGATGGCTGCTTCCCTCCTACGGCTTCATTTTCATGACTGCTTTGTCAA
CGTAATCAATTTTTCTATATATA
ATATTAGAGTACTCTAAGTGCATGGCCATGGGATTTTTTTTTATAAAAAAATCTGCTTTTCAGAGCTATATTCCATGTCTGTTTTTGAAAAAATGCTCTACCTTCTTTTTTGATCCTCGG
GTGAGGATGATCTTGTTTACGGGAATGAATGACCTGTTTGGATTCACTTAAAAAAAAGTTTTTAAACATTTTTGTATTTATAAATATTTATTTTAACACAAGCTTGTTAATAACTTAACA
AGAAAATTAAAACTATCGTTCTGATAGAACAGTTGGTGAACTTTTCTTTGTTTCTGTTCTAGGGTTGTGATGGATCATTGTTGCTTGACGACACTAACACATTTAAGGGGGAGAAAAATG
CATTGCCGAATGTGAACTCAGTTCGAGGCTACGAAGTTATTGATAATATAAAGGCTGTCTTAGAGAAATTCTGTCCATCTGTTGTCTCATGTACTGATATAGTAACTCTAGCAGCTAGAG
AAGCTGTCTACCT
GGTAAGCCAAATCTTTTTAGTTCACACAACTCTCTCAAACAACATCATGCTTTTGTATCTTTCTGAATCTTTCCTTTCCAGGCTGGGGGACCATTTTGGCAAATTCC
TCTTGGTCGTCGAGACGGCACGACAGCAAGCGAGAGTGAAGCCAATCAGCTGCCGTCACCAGTGGAGCCATTGGAGGATATCATTGCGAAATTCACTTCGAAAGGCTTCAATGTGAAGGA
TGTTGTTGCTCTCTCA
GGTCACCTTTCTCATGCCTCATCTTTGTACTTCCTCCCAGCTTTAAATCTATCCTAACCATCATTGCACAACTAACGTACAGGTGCACACACTTTCGGATTTGC
TCGGTGTATGATGTTCAAGCATAGGCTGTTCAACTTTGACGGCGCTGGAAATCCCGATCCAGAACTCGATGTCATGCTGCGACAGAACTTACAGAACAACTGTCCAAATCAAGATGATTC
CAACAACAAATTCGCCCCCTTAGATGCGTACACGATCAACCGGTTCGACAATGTGTATTATAGGAACTTGGTGAACAAGTTGGGACTCCTGCAGTCAGACCAAGATCTCATGAAAGACAA
TACAACTGCTTCTTTGGTGGTGAGCTACAGCAGGTATCCGTATATGTTTTACAGGGATTTTGGAGCATCAATGGTGAAGCTAGCCAATACTGGGATCCTTACAGGCCAAAATGGGGAGAT
TAGGAAGAATTGCAGGGTGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAAGATAACTCCTCCAAATATGTTGTTGTTTTGGTTATAAGCTTCTTTTTCTTGAATCAGGTCCTTGTGTCCTCACAACTTGATTATAGGTTCTACGATGCCTCTTGTCCCAATCTAA
CAAGGATTGTCAGATATGGCGTCTGGATGGCAGTTTCTAATGATACTAGGATGGCTGCTTCCCTCCTACGGCTTCATTTTCATGACTGCTTTGTCAA
GGGTTGTGATGGATCATTGTTGC
TTGACGACACTAACACATTTAAGGGGGAGAAAAATGCATTGCCGAATGTGAACTCAGTTCGAGGCTACGAAGTTATTGATAATATAAAGGCTGTCTTAGAGAAATTCTGTCCATCTGTTG
TCTCATGTACTGATATAGTAACTCTAGCAGCTAGAGAAGCTGTCTACCT
GGCTGGGGGACCATTTTGGCAAATTCCTCTTGGTCGTCGAGACGGCACGACAGCAAGCGAGAGTGAAGCCA
ATCAGCTGCCGTCACCAGTGGAGCCATTGGAGGATATCATTGCGAAATTCACTTCGAAAGGCTTCAATGTGAAGGATGTTGTTGCTCTCTCA
GGTGCACACACTTTCGGATTTGCTCGGT
GTATGATGTTCAAGCATAGGCTGTTCAACTTTGACGGCGCTGGAAATCCCGATCCAGAACTCGATGTCATGCTGCGACAGAACTTACAGAACAACTGTCCAAATCAAGATGATTCCAACA
ACAAATTCGCCCCCTTAGATGCGTACACGATCAACCGGTTCGACAATGTGTATTATAGGAACTTGGTGAACAAGTTGGGACTCCTGCAGTCAGACCAAGATCTCATGAAAGACAATACAA
CTGCTTCTTTGGTGGTGAGCTACAGCAGGTATCCGTATATGTTTTACAGGGATTTTGGAGCATCAATGGTGAAGCTAGCCAATACTGGGATCCTTACAGGCCAAAATGGGGAGATTAGGA
AGAATTGCAGGGTGGTGAACTAG

Retrieve as FASTA