Entry information : CsaPrx34 ( Cucsa.118700.1)
Entry ID 8821
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2016-01-15 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-15 (Achraf Jemmat)
Peroxidase information: CsaPrx34 ( Cucsa.118700.1)
Name (synonym) CsaPrx34 ( Cucsa.118700.1)
Class Class III peroxidase    [Orthogroup: Prx097]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx34
start..stop
S start..stop
MtPrx18 454 7e-162 51..338 46..333
GmPrx167 442 5e-157 51..338 51..338
PpePrx49 441 2e-156 36..338 32..335
GmPrx[P]269 432 2e-153 38..338 29..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..279 279 N° 2 947..1705 759  
join(1..279,947..1705)


exon

Literature and cross-references CsaPrx34 ( Cucsa.118700.1)
DNA ref. GenBank:   NC_026660.1 (9380937..9382641) Phytozome 12:   scaffold00998 (580647..578962)
Cluster/Prediction ref. Genebank:   101204209
Protein sequence: CsaPrx34 ( Cucsa.118700.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (322)
PWM (Da):   %s   38139.79 (35644.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.29 (9.10) Peptide Signal:   %s   cut: 22 range:22-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRFMASSFALFFLLHLHFIVSLPAIQPVLTVASASRAPPSSAASLLSHNFYHRTCPDAEGIIHRKVLAWINKDFTLAPALIRLHFHDCAVRGCDGSILLNYRRSERDALASKTLRGFSVIDDIKAELERKCPKTVSCSDILTAAARDATILAGGPFWEVPFGRKDGKISIAAEAEKVPQGHENVTALINYFQYLGLDTLDLVALSGAHTIGRAACHTFQDRLYNFNRTGRPDPVLKPRFLNMLRRQCKKGMDLVFLDATTPKMFDTAYFTNLEKKLGLLVTDQALVSDERTSSFVDLMANQPFLFDSQFSASMVKLGNVGVLTRKNEGEIRVNCNFVNHRRKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromom 6, intron 1). Incorrect prediction from phytozome (5' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTCATGGCTATGGCTTCTTCTTTTGCTCTCTTCTTCCTCCTTCATCTCCATTTCATTGTATCGTTGCCCGCCATTCAACCAGTACTTACCGTTGCCTCGGCAAGTCGTGCACCA
CCTTCGTCTGCAGCCTCTCTATTGTCGCATAACTTTTACCATCGAACATGCCCAGATGCCGAGGGCATCATTCATCGAAAAGTGCTAGCTTGGATCAACAAGGATTTCACATTGGCTCCG
GCCCTCATTCGCTTGCATTTCCACGATTGCGCAGTTAGG
GTAAGCATTATCATCCCATCTCCTGAGCTTCTTATATGTATCATTATTTATGTTAATTAATTTCTATATTCTGAGAACATC
TAATTATTTTTGTCTAAAATAGACCCAATGATATTTAATTTTATCTTTATAGTTTCAAGAAAATTAGTTAAGATTTAGCCTAATTAAATTCTAATTTAGTTGATCCTCTAAAACATCTCA
ACATCATCAATATCTAATTGAAGGTTTTTAAAAATCTCATTATAACAAAACAAAATTGAAACTAACTTTAAATGATAGAGGATCAATGAAATGTATCCTACAAGTCAAATTTAATTAGTA
GAACGGTTAGTTCTTGATTATTGATTTTTTTTTTACACAGTTTAATCTCTATTGTTTAAAACTTAGAAGGTTGGAATTTTTTCACTTATATATTTTTCAAAATTATAGTTTCATAAAAAA
AAAATTAAAATGACCCAAAATGCGACAATTAGGGTTTAGGTATATAGAACATTTTTACATAATTAATATAGTTATTTGCGTGTGATGAACTGATCTCTTACTAGATGAGTTGACAGTGAT
TTAGTTTATGAGTAGTTCAAGAATTTGATATATATGAAAATGTAAGATTGATCATGCAAAGATATTTCTTAAAATTTGAATACGAATTATGTAATAATGATGATAGGGATGCGATGGATC
GATTCTACTAAACTATCGAAGAAGTGAAAGAGACGCCTTAGCCAGCAAAACCCTAAGAGGATTTTCAGTGATCGACGATATCAAGGCCGAACTCGAGCGAAAATGCCCTAAAACCGTCTC
CTGCTCCGACATTCTCACTGCCGCCGCACGAGACGCCACCATTCTCGCCGGAGGCCCTTTCTGGGAGGTTCCATTCGGCCGTAAAGATGGCAAAATCTCCATCGCCGCCGAAGCAGAGAA
AGTCCCTCAAGGCCACGAAAACGTCACTGCTTTGATCAATTACTTCCAATATCTAGGGCTCGACACTCTCGATTTAGTCGCCCTCTCCGGCGCCCATACCATTGGCCGAGCCGCCTGCCA
TACCTTCCAAGATAGGCTCTACAATTTCAATAGGACAGGAAGACCGGACCCGGTTCTGAAACCTCGATTTCTGAATATGCTTCGAAGGCAGTGCAAGAAGGGTATGGATTTGGTTTTTCT
TGATGCGACGACTCCGAAAATGTTCGATACTGCTTATTTCACAAATCTTGAGAAGAAATTAGGGCTTCTGGTGACGGATCAAGCTCTGGTTTCGGATGAGAGAACTTCTTCGTTTGTGGA
TTTGATGGCGAATCAGCCGTTCCTTTTTGATAGCCAATTTTCTGCTTCGATGGTGAAATTGGGGAATGTGGGAGTTCTTACAAGGAAAAATGAAGGGGAAATTCGAGTTAATTGCAATTT
CGTTAATCATAGAAGAAAGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTCATGGCTATGGCTTCTTCTTTTGCTCTCTTCTTCCTCCTTCATCTCCATTTCATTGTATCGTTGCCCGCCATTCAACCAGTACTTACCGTTGCCTCGGCAAGTCGTGCACCA
CCTTCGTCTGCAGCCTCTCTATTGTCGCATAACTTTTACCATCGAACATGCCCAGATGCCGAGGGCATCATTCATCGAAAAGTGCTAGCTTGGATCAACAAGGATTTCACATTGGCTCCG
GCCCTCATTCGCTTGCATTTCCACGATTGCGCAGTTAGG
GGATGCGATGGATCGATTCTACTAAACTATCGAAGAAGTGAAAGAGACGCCTTAGCCAGCAAAACCCTAAGAGGATTTTCA
GTGATCGACGATATCAAGGCCGAACTCGAGCGAAAATGCCCTAAAACCGTCTCCTGCTCCGACATTCTCACTGCCGCCGCACGAGACGCCACCATTCTCGCCGGAGGCCCTTTCTGGGAG
GTTCCATTCGGCCGTAAAGATGGCAAAATCTCCATCGCCGCCGAAGCAGAGAAAGTCCCTCAAGGCCACGAAAACGTCACTGCTTTGATCAATTACTTCCAATATCTAGGGCTCGACACT
CTCGATTTAGTCGCCCTCTCCGGCGCCCATACCATTGGCCGAGCCGCCTGCCATACCTTCCAAGATAGGCTCTACAATTTCAATAGGACAGGAAGACCGGACCCGGTTCTGAAACCTCGA
TTTCTGAATATGCTTCGAAGGCAGTGCAAGAAGGGTATGGATTTGGTTTTTCTTGATGCGACGACTCCGAAAATGTTCGATACTGCTTATTTCACAAATCTTGAGAAGAAATTAGGGCTT
CTGGTGACGGATCAAGCTCTGGTTTCGGATGAGAGAACTTCTTCGTTTGTGGATTTGATGGCGAATCAGCCGTTCCTTTTTGATAGCCAATTTTCTGCTTCGATGGTGAAATTGGGGAAT
GTGGGAGTTCTTACAAGGAAAAATGAAGGGGAAATTCGAGTTAATTGCAATTTCGTTAATCATAGAAGAAAGAAGTAA

Retrieve as FASTA