Entry information : CsaPrx35 ( Cucsa.124250.1)
Entry ID 8822
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2016-01-15 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-15 (Achraf Jemmat)
Peroxidase information: CsaPrx35 ( Cucsa.124250.1)
Name (synonym) CsaPrx35 ( Cucsa.124250.1)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx35
start..stop
S start..stop
VvPrx38 468 2e-167 28..327 31..327
MePrx06 466 7e-167 23..327 28..328
PtPrx08 465 2e-166 23..327 29..329
PpePrx66 465 2e-166 7..327 10..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..67 67 N° 2 193..344 152 N° 3 450..647 198 N° 4 736..901 166
N° 5 1074..1477 404  
join(1..67,193..344,450..647,736..901,1074..1477)


exon

Literature and cross-references CsaPrx35 ( Cucsa.124250.1)
DNA ref. GenBank:   NC_026660.1 (20666191..20664715) Phytozome 12:   scaffold01001 (228858..227525)
Cluster/Prediction ref. Genebank:   101221151
Protein sequence: CsaPrx35 ( Cucsa.124250.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (303)
PWM (Da):   %s   36755.69 (34096.1)  
PI (pH):   %s   5.92 (5.40) Peptide Signal:   %s   cut: 26 range:26-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLGVSIKFVILLLSFLLLSNVGKSQELVVNYYNQSCPQAEEIIKQQVFSLYQKHGNSAISWIRNLFHDCMVSCDASLLLEMKNEEGVVISEMKSPRSFGIRNLKYVNKIKQVLENECPNTVSCADIMALAARDAIVLLGGLEMEMKTGRRDSKESYGEMVEEFIPNHNDSLSLVLSRFQDIGIDAEATVALLGAHSIGRVHCVNLVNRLYPTVDPTLDPNHALYLQKRCPNPDPDPKAVQYARNDLESPMVVDNNYYRNVLDHKALLLVDQQLGSSPITLPYVQQMASNNTYFLAQFARALLLLSENNPLTDDQGEIRKDCRRVNK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 introns and extra 5'). Incorrect prediction from phytozome (5' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTTGGGGTCTCAATTAAATTTGTGATTCTTCTATTATCTTTCCTCCTCCTTTCCAATGTTGGTATGCATTTTTACTCTTTATTAATGTTATATATCCTATACCCAAAATGACAC
ATTGTTTAGATTTATTTTAAATTTTTGTCAATTCAAACGCTGTTCTTAAGTTCGTTATATATTTAATTACAGGGAAAAGCCAAGAACTTGTGGTGAATTACTACAACCAAAGTTGCCCAC
AAGCTGAGGAAATAATCAAACAACAAGTTTTTTCCTTGTACCAAAAACATGGAAATTCAGCCATTTCATGGATTAGAAATCTCTTCCACGATTGCATGGTCAAG
GTGCATATACATATAT
ATGAACAAAATCTTCTATTGAATTATATTTTCTTTGTATATTATTAATGCTTTTTTGTTTTGTTTTGTTTAATTGTTAAATACATGCAGTCATGTGATGCATCTCTTTTATTAGAGATGA
AAAATGAAGAAGGTGTAGTTATATCAGAAATGAAGTCACCAAGAAGCTTTGGGATAAGAAATCTTAAATATGTTAACAAAATCAAACAAGTTCTTGAAAATGAATGCCCCAACACTGTCT
CCTGTGCTGATATTATGGCTCTCGCTGCAAGAGATGCTATTGTTCTG
GTAATTATTATTAAACCAATAATGACGTTGTTACATTTATATTCTTGAACTGACGGACTGAGTTTATTGTAAT
ATTGGGTATTAAAAGTTAGGGGGATTAGAGATGGAAATGAAGACAGGAAGAAGAGATAGCAAAGAGAGCTATGGAGAAATGGTGGAAGAATTTATACCAAATCACAATGACTCACTTTCA
TTGGTTCTTTCTCGCTTTCAAGATATTGGCATTGATGCTGAAGCTACCGTTGCTCTTTTAG
GTCTAATCTCAATTCACCTTTTTGTTATATTTTCTCTTAAAAATAACCACAATGCATAT
TTATAAGTCAGATTTTAAAGAAACCTAATGAAAGTAGATGAGATTAGAGGTAAAAAACAACCTGTTTTGTTGAGCAATATTTGAGTCCATATAATCTTAATTTTATATGTTAGGAGCTCA
CTCAATTGGTCGAGTCCACTGTGTAAACTTAGTGAACCGACTCTATCCGACCGTGGACCCGACTTTGGATCCGAACCACGCACTTTATCTTCAAAAAAGGTGCCCAAACCCGGACCCGGA
CCCGAAGGCAGTCCAATACGCGAGAAACGATTTGGAATCGCCAATGGTGGTGGACAACAACTACTACAGAAATGTATTGGACCACAAGGCCCTTTTATTAGTGGATCAGCAATTGGGCTC
AAGCCCAATAACTCTTCCTTATGTCCAACAAATGGCCTCCAATAACACCTACTTTCTGGCCCAATTTGCTAGGGCTTTGCTCTTGCTGTCTGAGAACAACCCTCTCACTGATGACCAAGG
AGAGATTAGAAAGGATTGTCGACGTGTCAACAAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTTGGGGTCTCAATTAAATTTGTGATTCTTCTATTATCTTTCCTCCTCCTTTCCAATGTTGGGAAAAGCCAAGAACTTGTGGTGAATTACTACAACCAAAGTTGCCCACAAGCT
GAGGAAATAATCAAACAACAAGTTTTTTCCTTGTACCAAAAACATGGAAATTCAGCCATTTCATGGATTAGAAATCTCTTCCACGATTGCATGGTCAAG
TCATGTGATGCATCTCTTTTA
TTAGAGATGAAAAATGAAGAAGGTGTAGTTATATCAGAAATGAAGTCACCAAGAAGCTTTGGGATAAGAAATCTTAAATATGTTAACAAAATCAAACAAGTTCTTGAAAATGAATGCCCC
AACACTGTCTCCTGTGCTGATATTATGGCTCTCGCTGCAAGAGATGCTATTGTTCTG
TTAGGGGGATTAGAGATGGAAATGAAGACAGGAAGAAGAGATAGCAAAGAGAGCTATGGAGAA
ATGGTGGAAGAATTTATACCAAATCACAATGACTCACTTTCATTGGTTCTTTCTCGCTTTCAAGATATTGGCATTGATGCTGAAGCTACCGTTGCTCTTTTAG
GAGCTCACTCAATTGGT
CGAGTCCACTGTGTAAACTTAGTGAACCGACTCTATCCGACCGTGGACCCGACTTTGGATCCGAACCACGCACTTTATCTTCAAAAAAGGTGCCCAAACCCGGACCCGGACCCGAAGGCA
GTCCAATACGCGAGAAACGATTTGGAATCGCCAATGGTGGTGGACAACAACTACTACAGAAATGTATTGGACCACAAGGCCCTTTTATTAGTGGATCAGCAATTGGGCTCAAGCCCAATA
ACTCTTCCTTATGTCCAACAAATGGCCTCCAATAACACCTACTTTCTGGCCCAATTTGCTAGGGCTTTGCTCTTGCTGTCTGAGAACAACCCTCTCACTGATGACCAAGGAGAGATTAGA
AAGGATTGTCGACGTGTCAACAAATGA

Retrieve as FASTA