Entry information : CsaPrx44 ( Cucsa.148370.1)
Entry ID 8831
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2016-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-27 (Achraf Jemmat)
Peroxidase information: CsaPrx44 ( Cucsa.148370.1)
Name (synonym) CsaPrx44 ( Cucsa.148370.1)
Class Class III peroxidase    [Orthogroup: Prx044]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx44
start..stop
S start..stop
VvPrx30 471 1e-168 4..329 3..327
VvPrx31 464 3e-166 6..329 5..327
PpePrx14 457 2e-163 23..329 21..328
PtPrx29 452 2e-161 1..329 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 488288..488515 228 N° 2 487905..488093 189 N° 3 487295..487460 166 N° 4 486799..487205 407
complement(join(486799..487205,487295..487460,487905..488093,488288..488515))


exon

Literature and cross-references CsaPrx44 ( Cucsa.148370.1)
DNA ref. Phytozome 12:   scaffold01107 (488515..486802)
Protein sequence: CsaPrx44 ( Cucsa.148370.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (301)
PWM (Da):   %s   35672.4 (32456.6) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.34 (9.06) Peptide Signal:   %s   cut: 29 range:29-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAITPKLFFLLLLQLIFVSTSLSNIARANELAVGFYKNCCPGVEYIVAKTVAQYVKKQPAIAASLLRIHFHDCFVRGCDGSVLLNSGPNNQAEKDAIPNLSLRGYNVVDAVKAAVEKQCPGVVSCADILALIARDAVRMSGGPAWEVPTGRRDGTVSISREALINLPPPFANISSLKSSFQSKGLSLKDLVVLSGAHTIGVSHCTSFSNRLYNFTGKGDADPKLDKYYAAALKIKCKPNDQKKIVEMDPGSFKTFDQSYYTLVSKRRGLFQSDSALLDDPDTKAYVQFQSSTRGSTFPADFAKSMINMGNIGVLTGTDGEIRRRCGFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATTACTCCAAAGCTTTTCTTCCTTCTCCTTTTGCAGCTAATATTTGTATCAACATCTCTCTCAAACATCGCCAGAGCAAATGAGTTGGCGGTTGGGTTTTACAAGAATTGCTGC
CCTGGGGTGGAGTATATCGTCGCCAAGACGGTGGCTCAATATGTTAAGAAACAACCAGCAATAGCTGCTTCTTTGTTGAGGATACACTTCCATGACTGCTTTGTTAGG
GTATATAAGTAA
CTATATACTTTTTGTTTTTTTGACAATGAATTGGCAGTGACAAGGAACACTAAGACACTTTTATTTATATATATATATATATATATATTGATACTTTTATTTATCTAAATTTATTACCAT
TAAAAAATGAGAAAGTTAAATAAGAGAAAACTCACTTGATTGATCTGATAATTATTTGATAGGGATGTGATGGTTCAGTGCTGCTAAATTCCGGACCAAATAACCAAGCTGAGAAAGATG
CCATTCCCAACCTTAGTTTAAGAGGTTATAATGTTGTTGATGCCGTTAAAGCTGCCGTTGAAAAGCAATGTCCTGGTGTTGTTTCTTGTGCTGACATCCTTGCTTTGATAGCTCGTGATG
CTGTTAGAATG
GTAATTTACAAATTTATATAAAGGTTCTTTATTTTTTTAATTTTAAAATGTTGATCTAAAACTATAACTTTAGACACGAACCACAAATAATGATATTGAATGTTAATTT
TTTTAAGAAATAAGACTTAGAAAAAGATGTGAGCTGTGATGATTTGAAATCCTAACAACTTTAATTTCTATAGAGATCATGAAGGAGTGAGTTTGCATGTTAATGTAAAATCTAAAAAAT
GGATGTTGGAAAATCCCAATACTCTACTATTAAGCAATTATTAACAACTTATAATATTAAGCAATTATTTCTAGAAGTTTACTTTTAAAAAAAATTAGTTTTTTTTTTTAAAAAAACAAT
GTTAATTAAATATGTTGACGTAGGAGAATATTTATAATTATTTAGAATTGAAAAGAGAAAATTTATTTAGTTATTTATTATTAATTTGAAAATAGAGTGGAGGCCCAGCTTGGGAAGTTC
CAACGGGAAGAAGAGACGGAACTGTATCAATCTCACGAGAAGCATTGATTAATCTGCCTCCTCCTTTCGCTAATATCTCTTCTCTCAAATCAAGTTTCCAATCCAAAGGTCTCTCCCTCA
AAGATCTTGTCGTTCTATCCG
GTAAGTTCTTTCTTCAACACTCTCAATGATTTACAATTTCCTTTCGATATGATTACGTTGATTTTAACACACTTCAATTTGATCTTCAGGAGCACATAC
AATCGGAGTCTCTCACTGTACCTCTTTCTCCAATCGCCTCTACAATTTCACCGGCAAAGGCGACGCCGATCCCAAACTAGACAAATACTACGCGGCCGCACTCAAGATCAAATGCAAACC
AAATGACCAAAAAAAAATCGTCGAGATGGATCCTGGAAGCTTCAAGACCTTCGATCAAAGTTATTACACACTCGTTTCCAAGAGAAGAGGATTGTTCCAGTCTGATTCCGCTCTTCTCGA
CGATCCTGATACTAAAGCCTACGTTCAGTTTCAGTCTAGTACACGTGGCTCTACTTTCCCCGCCGATTTCGCTAAATCCATGATTAATATGGGGAATATCGGCGTTCTCACCGGTACCGA
CGGTGAAATTAGGCGCCGGTGTGGTTTTGTTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATTACTCCAAAGCTTTTCTTCCTTCTCCTTTTGCAGCTAATATTTGTATCAACATCTCTCTCAAACATCGCCAGAGCAAATGAGTTGGCGGTTGGGTTTTACAAGAATTGCTGC
CCTGGGGTGGAGTATATCGTCGCCAAGACGGTGGCTCAATATGTTAAGAAACAACCAGCAATAGCTGCTTCTTTGTTGAGGATACACTTCCATGACTGCTTTGTTAGG
GGATGTGATGGT
TCAGTGCTGCTAAATTCCGGACCAAATAACCAAGCTGAGAAAGATGCCATTCCCAACCTTAGTTTAAGAGGTTATAATGTTGTTGATGCCGTTAAAGCTGCCGTTGAAAAGCAATGTCCT
GGTGTTGTTTCTTGTGCTGACATCCTTGCTTTGATAGCTCGTGATGCTGTTAGAATG
AGTGGAGGCCCAGCTTGGGAAGTTCCAACGGGAAGAAGAGACGGAACTGTATCAATCTCACGA
GAAGCATTGATTAATCTGCCTCCTCCTTTCGCTAATATCTCTTCTCTCAAATCAAGTTTCCAATCCAAAGGTCTCTCCCTCAAAGATCTTGTCGTTCTATCCG
GAGCACATACAATCGGA
GTCTCTCACTGTACCTCTTTCTCCAATCGCCTCTACAATTTCACCGGCAAAGGCGACGCCGATCCCAAACTAGACAAATACTACGCGGCCGCACTCAAGATCAAATGCAAACCAAATGAC
CAAAAAAAAATCGTCGAGATGGATCCTGGAAGCTTCAAGACCTTCGATCAAAGTTATTACACACTCGTTTCCAAGAGAAGAGGATTGTTCCAGTCTGATTCCGCTCTTCTCGACGATCCT
GATACTAAAGCCTACGTTCAGTTTCAGTCTAGTACACGTGGCTCTACTTTCCCCGCCGATTTCGCTAAATCCATGATTAATATGGGGAATATCGGCGTTCTCACCGGTACCGACGGTGAA
ATTAGGCGCCGGTGTGGTTTTGTTAACTGA

Retrieve as FASTA