Entry information : CsaPrx69 (Cucsa.217830.1)
Entry ID 8844
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaPrx69 (Cucsa.217830.1)
Name (synonym) CsaPrx69 (Cucsa.217830.1)
Class Class III peroxidase     [Orthogroup: Prx005]*
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx69
start..stop
S start..stop
CsaPrx68 434 4e-154 8..326 14..330
RcPrx54 430 1e-152 6..326 5..324
CclPrx41 428 8e-152 7..326 7..325
CsPrx44 427 1e-151 7..326 7..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 73706..74098 393 N° 2 73413..73572 160 N° 3 72655..73085 431  
complement(join(72655..73085,73413..73572,73706..74098))


exon

Literature and cross-references CsaPrx69 (Cucsa.217830.1)
DNA ref. Phytozome 12:   scaffold01658 (74098..72655)
Protein sequence: CsaPrx69 (Cucsa.217830.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   35938.37 (33377.9)  
PI (pH):   %s   8.01 (7.74) Peptide Signal:   %s   cut: 24 range:24-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKVGFILIVYVVVVLHSNAVHGQGTRLGFYRATCPQVEFIVRSTVRSHFQLDPSIAPGLLRMHSHDCFVRGCDASVLLAGPNSERTAVPNRTLKGFEVIDDAKSQLEDICPGVVSCADILALAARDSVVLTGGRSWEVPTGRRDGRVSLVSEVKLPGFSDSIEVQKEKFRSMGLNTHDLVTLAGAHTIGTASCRFFSYRLYNFTTVTETGADPTLNPSLVERLREVCPVDGDSSNRFELDIDSAEKFDVSFYKNLRQGGGILESDQMLWNDDSTRPIIQHYLSLKGLVGRSSFKVEFGRSMVKMSNAQVKTGLLGEIRRVCSKVNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAAGTTGGTTTCATTTTAATTGTATACGTAGTGGTGGTGTTGCATAGCAACGCTGTGCATGGCCAAGGCACACGCCTTGGCTTTTATCGTGCCACGTGCCCACAAGTCGAATTC
ATCGTTAGATCCACGGTTCGATCTCATTTTCAATTAGATCCATCGATCGCTCCTGGGTTGTTAAGAATGCATTCACATGATTGCTTCGTCCGAGGGTGTGATGCTTCTGTGCTTCTTGCT
GGTCCCAATTCTGAGAGGACGGCTGTGCCTAACCGTACTTTGAAAGGGTTTGAGGTCATTGATGATGCCAAGTCACAACTTGAGGATATCTGCCCAGGTGTTGTCTCCTGTGCTGATATT
CTTGCTCTTGCTGCTCGTGACTCAGTGGTTCTG
GTAAGTATTCAATTACTTTGTATGTGAAAATCTCATCTCATTAACACTTCTTTCTAGTCCCAATTTTAATGAATGTTAAGACTGTAT
ATTAGTATGTGGATGAAAATTTAATACCGTAATTTGGTTGCTGCAGACAGGTGGAAGAAGTTGGGAAGTTCCGACGGGACGAAGAGATGGCAGAGTTTCATTAGTTTCCGAGGTGAAGTT
GCCTGGTTTTTCAGATTCCATTGAAGTTCAAAAGGAGAAGTTCAGATCTATGGGGCTCAACACACATGACCTCGTAACTCTCGCAG
GTATATATATAAGACTTAGTTGATTATGATAAAC
AAGCCTCCACCAAAAACCAAATTTGTTTTCTACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCACTATAAGCATGAATATAAAAGTAGACTAAAGCAAAATAGTTATCA
AATTTGCTACGAAAATTCACACCTTTTTCTTCCTCATTAAACCATATATATAGGTGCCCATACCATTGGTACTGCATCGTGTCGTTTTTTCAGTTATAGACTCTACAACTTCACAACAGT
CACTGAAACCGGTGCTGACCCAACTCTTAATCCATCACTCGTCGAACGACTACGAGAAGTTTGCCCTGTAGACGGAGATAGCTCAAACAGATTTGAACTCGACATCGATAGTGCAGAAAA
GTTTGACGTATCGTTCTACAAAAACTTGAGACAAGGAGGAGGGATCTTAGAGTCGGATCAAATGTTGTGGAACGATGATTCTACTCGCCCTATCATCCAACACTATTTGAGTTTAAAAGG
TTTAGTAGGGCGTTCAAGCTTTAAAGTTGAGTTTGGAAGATCGATGGTTAAAATGAGCAATGCACAAGTTAAAACTGGCCTTCTTGGTGAAATTCGAAGGGTTTGCTCTAAGGTTAATAA
TTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAAGTTGGTTTCATTTTAATTGTATACGTAGTGGTGGTGTTGCATAGCAACGCTGTGCATGGCCAAGGCACACGCCTTGGCTTTTATCGTGCCACGTGCCCACAAGTCGAATTC
ATCGTTAGATCCACGGTTCGATCTCATTTTCAATTAGATCCATCGATCGCTCCTGGGTTGTTAAGAATGCATTCACATGATTGCTTCGTCCGAGGGTGTGATGCTTCTGTGCTTCTTGCT
GGTCCCAATTCTGAGAGGACGGCTGTGCCTAACCGTACTTTGAAAGGGTTTGAGGTCATTGATGATGCCAAGTCACAACTTGAGGATATCTGCCCAGGTGTTGTCTCCTGTGCTGATATT
CTTGCTCTTGCTGCTCGTGACTCAGTGGTTCTG
ACAGGTGGAAGAAGTTGGGAAGTTCCGACGGGACGAAGAGATGGCAGAGTTTCATTAGTTTCCGAGGTGAAGTTGCCTGGTTTTTCA
GATTCCATTGAAGTTCAAAAGGAGAAGTTCAGATCTATGGGGCTCAACACACATGACCTCGTAACTCTCGCAG
GTGCCCATACCATTGGTACTGCATCGTGTCGTTTTTTCAGTTATAGA
CTCTACAACTTCACAACAGTCACTGAAACCGGTGCTGACCCAACTCTTAATCCATCACTCGTCGAACGACTACGAGAAGTTTGCCCTGTAGACGGAGATAGCTCAAACAGATTTGAACTC
GACATCGATAGTGCAGAAAAGTTTGACGTATCGTTCTACAAAAACTTGAGACAAGGAGGAGGGATCTTAGAGTCGGATCAAATGTTGTGGAACGATGATTCTACTCGCCCTATCATCCAA
CACTATTTGAGTTTAAAAGGTTTAGTAGGGCGTTCAAGCTTTAAAGTTGAGTTTGGAAGATCGATGGTTAAAATGAGCAATGCACAAGTTAAAACTGGCCTTCTTGGTGAAATTCGAAGG
GTTTGCTCTAAGGTTAATAATTGA

Retrieve as FASTA