Entry information : CsaPrx78 (Cucsa.292700.1)
Entry ID 8851
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaPrx78 (Cucsa.292700.1)
Name (synonym) CsaPrx78 (Cucsa.292700.1)
Class Class III peroxidase    [Orthogroup: Prx110]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx78
start..stop
S start..stop
RcPrx09 477 2e-171 2..322 1..321
PtPrx78 470 1e-168 2..322 1..321
MtPrx66 459 2e-164 9..322 7..320
PpePrx26 458 4e-164 9..322 8..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 276726..276929 204 N° 2 277385..277564 180 N° 3 277702..277864 163 N° 4 278888..279312 425
join(276726..276929,277385..277564,277702..277864,278888..279312)


exon

Literature and cross-references CsaPrx78 (Cucsa.292700.1)
DNA ref. Phytozome 12:   scaffold02779 (276726..279312)
Protein sequence: CsaPrx78 (Cucsa.292700.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (302)
PWM (Da):   %s   35699.92 (33155.5)  
PI (pH):   %s   5.43 (5.21) Peptide Signal:   %s   cut: 22 range:22-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMGYIWWNLVAILAMVLPVKSQLSVGFYSKSCPKAEFIVRSTVESYFKADPTIAAGLLRLHFHDCFVQGCDGSVLIMDENAEINAGPNMGLRGFEVVDDAKAKLENLCPGVVSCADILTLATRDAIDLSDGPSWSVPTGRRDGKVSISFDAEDLPSPFEPIDNHIQKFAEKGLTEEDLVTLVGAHTIGRTDCQLFSYRLQNFTSTGNADPTISTSFLTELRTLCPLDGDPFRGVAMDKDSQLKFDNSFYKNLMDGNGVLESDQRLWSHPSTRDIVKRYGGNLRGLLGLRFSYEFKKAMVKLSSIGVKTGTQGEIRKVCYQFNK*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGGGTACATTTGGTGGAATTTAGTGGCAATTTTAGCAATGGTTTTGCCAGTGAAATCTCAACTCAGTGTTGGATTTTATTCAAAGTCTTGTCCTAAAGCTGAGTTCATTGTTAGG
TCTACTGTTGAGTCTTATTTCAAGGCTGATCCCACCATTGCTGCTGGCTTGCTCAGGCTTCACTTCCATGATTGTTTTGTTCAG
GTTTTTCATTTTTCCTTTTTCTTTTTCTCCAATTTT
TAAAAATGGAAATTATATAAACGGTCTAACACAGAATTATTATTTATATTCTATTTTAACCATTTTTACTTGTTTTTCTATTTTCTCATTTTATTTTTTAATGACAAATTAAGTAGAGTA
TATTTATGTTGTCAAAGTGAATATAATTCAAGAGTAATTGGTATGACTTTCTTTTTACAAAATTCAATTCTTCATCTCAACAATAGTTGGTCCTTGTAAAAAAAAGGGATTTGGTTTTAG
TACCTTTTGAAATCAAATTGAATGTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTATGCTGATAAAGAACATAG
AACATGTCTAATAAAACATTTCATCAATTAAGTTGCTGATTTTGATTGAACTTTGACAGGGATGCGATGGCTCAGTGTTGATAATGGATGAAAATGCTGAAATAAATGCAGGGCCAAACA
TGGGGTTAAGAGGATTTGAAGTCGTTGATGATGCAAAAGCCAAACTCGAAAATTTGTGTCCTGGTGTTGTTTCTTGTGCAGATATTCTTACTTTGGCTACTCGTGATGCCATAGACTTG
G
TAACTCTTCAATTTTATTCCTTTACTATAACCTCTTTAATTTTATAAATTCCAAGCTCTACTTCTTTAATTTGAATTGTTAATTTTGTGATATGTATTTTTCTTATTACAATGTTGAATT
TAAAAATATGTTTTAGAGTGATGGTCCAAGTTGGTCCGTGCCCACTGGAAGAAGAGACGGAAAAGTTTCGATCAGTTTTGATGCAGAAGATCTGCCTTCTCCATTCGAGCCCATCGATAA
CCACATACAAAAGTTTGCAGAGAAAGGCCTTACTGAAGAAGATCTTGTGACCTTAGTTG
GTTTGTACTCTCGTCTCTCTCCTTCTCTAATATCGTTAAAACCTAATGTTTACTGCTTTAT
GAAAAATATTTGGATGAATCTTGAACTGCAACAATTTCTGTGCAGTCTACACAAGTCTCTAACCACAAGTTTATTTCATGACAAAAACTATTTTTTTTAAAGGTACTTTCTTTTATAGTT
TTTTTCATTTATGGTGGAAGGGAATATACATGGTGCACCTAGGTATTAGTACTCATACAGTCATATACATCAATTCTGACATAATTTTTAGGCTTGAACAATAAATTAACACGCTACATA
TTATTAGAAGGTAGAACAATTGTTAAAAGTGATCATAAACTTCCCAATAATTGATATACCATTTTTTCCTTAAACAAAAAAGTTACAAATCTATGACCTTAAGAGAAGAGCTGTTAGTAT
ATAAATTAGAATTGAACTTAAACACACCTAGCATGTAGAAGTGATGAAATTATTATTTTACTAACGTATCCATCACATGGGACTTAAACATATCATTTAAAAAGACATTAACTTCAAGAT
AATTCCAATCGATAATACTTCAAGAAAGCATGGTAGAAAAGTGAAATTATTATTTTACTAAACGTACCCATGACATGGGACTAATTAAACATATCATTTAAAAGGACACATTAACTTTGA
GATAATTCCCCTCGATAATACTTTTAGCACTAATTTAGTTATGTATATAACTGAACTGCAAATATAGTCATATCTGTCATTAACTCCTATTATTAACGATATAGTCTATAACTAATAGAT
TTAATCAGGCAGGATTCATTTCTAAGTGTCAAAGTATCGACATCACATGTCTACCTGTTCAAACGTACAACAGTCCTTCAATAATTTAGTTATATACACTGTTAAGTCTTTTTATTAACT
GATTATATAATAACTAATCAATAACATATACTTTCTACCAAAAAGTTAGAGCAGCCAACAAGCATATATATATATTTAAATTGTTGGATTCAGTGGTAGTTTAACACGATCCTTGATGGC
AGGTGCTCATACGATCGGGCGAACGGATTGCCAACTATTCAGTTACCGTCTACAAAACTTCACAAGCACAGGGAATGCAGACCCAACCATAAGCACATCGTTCTTGACTGAACTGAGAAC
TCTTTGTCCTTTAGATGGAGATCCATTCAGAGGAGTGGCCATGGACAAAGACAGCCAATTGAAATTTGACAACAGCTTTTACAAGAACTTGATGGATGGAAATGGGGTTTTGGAGTCAGA
CCAAAGACTTTGGAGCCACCCTTCAACCAGAGACATTGTAAAAAGATATGGTGGAAACTTAAGGGGATTGTTGGGCCTTAGATTTAGCTATGAGTTCAAGAAAGCTATGGTTAAGTTGAG
TAGCATTGGTGTTAAGACTGGGACACAAGGGGAGATTAGAAAAGTTTGTTATCAGTTCAATAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGGGTACATTTGGTGGAATTTAGTGGCAATTTTAGCAATGGTTTTGCCAGTGAAATCTCAACTCAGTGTTGGATTTTATTCAAAGTCTTGTCCTAAAGCTGAGTTCATTGTTAGG
TCTACTGTTGAGTCTTATTTCAAGGCTGATCCCACCATTGCTGCTGGCTTGCTCAGGCTTCACTTCCATGATTGTTTTGTTCAG
GGATGCGATGGCTCAGTGTTGATAATGGATGAAAAT
GCTGAAATAAATGCAGGGCCAAACATGGGGTTAAGAGGATTTGAAGTCGTTGATGATGCAAAAGCCAAACTCGAAAATTTGTGTCCTGGTGTTGTTTCTTGTGCAGATATTCTTACTTTG
GCTACTCGTGATGCCATAGACTTG
AGTGATGGTCCAAGTTGGTCCGTGCCCACTGGAAGAAGAGACGGAAAAGTTTCGATCAGTTTTGATGCAGAAGATCTGCCTTCTCCATTCGAGCCC
ATCGATAACCACATACAAAAGTTTGCAGAGAAAGGCCTTACTGAAGAAGATCTTGTGACCTTAGTTG
GTGCTCATACGATCGGGCGAACGGATTGCCAACTATTCAGTTACCGTCTACAA
AACTTCACAAGCACAGGGAATGCAGACCCAACCATAAGCACATCGTTCTTGACTGAACTGAGAACTCTTTGTCCTTTAGATGGAGATCCATTCAGAGGAGTGGCCATGGACAAAGACAGC
CAATTGAAATTTGACAACAGCTTTTACAAGAACTTGATGGATGGAAATGGGGTTTTGGAGTCAGACCAAAGACTTTGGAGCCACCCTTCAACCAGAGACATTGTAAAAAGATATGGTGGA
AACTTAAGGGGATTGTTGGGCCTTAGATTTAGCTATGAGTTCAAGAAAGCTATGGTTAAGTTGAGTAGCATTGGTGTTAAGACTGGGACACAAGGGGAGATTAGAAAAGTTTGTTATCAG
TTCAATAAGTAG

Retrieve as FASTA