Entry information : CsaPrx82 (Cucsa.307020.1)
Entry ID 8853
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2014-01-09 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: CsaPrx82 (Cucsa.307020.1)
Name (synonym) CsaPrx82 (Cucsa.307020.1)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx82
start..stop
S start..stop
BstrPrx19 498 1e-179 9..320 13..327
AlyPrx21 495 2e-178 1..320 1..327
PpePrx66 489 4e-176 13..320 16..325
PtPrx08 489 7e-176 19..320 26..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 354513..354576 64 N° 2 354677..354825 149 N° 3 355415..355603 189 N° 4 355974..356134 161
N° 5 356929..357332 404  
join(354513..354576,354677..354825,355415..355603,355974..356134,356929..357332)


exon

Literature and cross-references CsaPrx82 (Cucsa.307020.1)
DNA ref. Phytozome 12:   scaffold02977 (354513..357617)
Protein sequence: CsaPrx82 (Cucsa.307020.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (297)
PWM (Da):   %s   36007.45 (33316.0)  
PI (pH):   %s   8 (7.47) Peptide Signal:   %s   cut: 25 range:25-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKTHFSFLLLLVLFQLFNSGRGQLQLNYYAKSCPKAEEIIKQQVIDLYYEHGNTAVSWLRNLFHDCIVKSCDASLLLETVVGVESEKDSSRSFGMRNFKYVNKIKAAVEKECPLTVSCADIVALSARDGILKGPHIDLKTGRKDSKMSYSNMVEELVPQHNASLVNVLSRFNSIGIDTEATVALLGSHSVGRVHCVNLVERLYPTVDPTIDPEYAKYLKMRCPTPTPDPNGVLYSRNDRETTMILDNMYYSNVLKHKGLLIVDQELVSNPLTLPYVKKFAADNLYFHAQFSRGIRLLSENNPLTGDQGEVRKDCRFVNK

Retrieve as FASTA  
Remarks Complete sequence from genomic. Containing IntR (5').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCAAAACCCATTTCAGCTTTCTTCTTCTTCTTGTTCTTTTTCAGCTCTTTAATTCAGGTCTGATTTTAGTTCCCTTCTTCTTCTTCTTTTTCATAACGATAAATTGTAATGTA
TTGTTTAATTTAATGGGTGAAATTTTGAAATAAAATGAAAATAGGAAGGGGCCAGTTGCAACTGAATTACTATGCAAAAAGTTGTCCAAAAGCTGAAGAGATTATAAAACAGCAAGTCAT
TGATCTTTACTATGAACATGGAAACACTGCTGTTTCGTGGCTCAGAAATCTCTTCCATGATTGCATTGTTAAG
GTAATTAATTAAACTTTATATTTTAATTAATTCCTTTAATCCTTTTG
GATACGGATGGAAAGCAAGATAAATAGACATATTATATGTTAATTAATTTTCTTTAAGTGCTTGCAAATTAATCATTTGGTTAACCCTACAAATTAAACCTATGTCCCCTCAGTATACTA
TTCTAACATAATTTATAGCTTTTACTATAGAGTATACTATTTGTGTTTTTGTGTGTGTGCTTATTTGTTAAAATAAAAATAAAATATCACACCACGAAATAAAAATAAATAAATAAAAAC
AATTATGTACATATTAAGATTGAAATTAATCTTAATTAGGCACTTTGGGAGGCTTGATGACCATATTAAGACAAAATTAAAAATTCATCGACTTTTCAAACAGTTTGAAGATAATATTAA
GTATTAAGAACTAAACTTATAATTTAACCTTAATTGTGAATTGACGTAATATTTAAGTAACTCGTTTTACAAATTCAACGTCAGCTACAGACGTGCATGAGTTTATGTAACATCATCGTG
TCAAATTGTGTTGAACTTATATCTTGAAATTAATAGTGTTTGGTGTGATTTGGTATTTGTAGTCTTGTGATGCGTCACTTCTGTTGGAGACGGTGGTGGGAGTGGAATCAGAGAAAGATT
CAAGCAGAAGCTTTGGAATGAGAAATTTCAAATATGTAAATAAGATTAAAGCTGCTGTTGAGAAAGAGTGCCCTCTCACTGTTTCTTGTGCTGACATCGTTGCTCTCTCTGCTAGAGATG
GCATAGTTATG
GTATATTATTTCATCATCTTTCTCTCAAACTTTGTCGTTGTTTGTTTTGAAAACATTTAAAAAAAATTGCAACAACAACCTCTAGTACAGTAGGAATCCACTAAAACAT
TATATAAAAATTGAGACATGAAACGAGAGTGACAGTGTTCGAGTTTCAACATTCTTTTCAAATAACCATCACATATTGGTTTCATACTCCAACTTTTGTCCAAAGCTTTAATGAATTCCC
ACTCCAAAATGTAGTTTTAAAATATTTAAAAAAGACAAACTATATAACTCGTAACTCTTTCAATGACGAAGATATATTCTTTTATCCATAAAATTTGTGTTTGTTCTTTTTGTAATGGGG
TGAAATTGATGTACAGTTAAAAGGGCCTCATATAGATTTGAAAACCGGAAGAAAAGACAGCAAAATGAGTTATTCAAATATGGTTGAGGAGTTGGTTCCACAGCACAACGCATCTCTTGT
AAATGTTCTCTCTCGTTTTAACTCCATTGGTATTGATACTGAAGCAACAGTCGCCCTTTTAG
GTTTGTATTATTATTCTTTTCAACTCTTTTGTTTCTTGTTCGTCAATTTACAAGTCTA
CTTTATACAATTTTGAGTTAGTTACATTTATTTATTCTCTGATTGACTTACTCGACCTTGATTTTATTAGACAAATACATATCGTTTTCCTCAAACTTAACTTAATAACTTATTAGATAA
TTTTAAAAGAGTAAAAAAAACTCAAAGTTGTAATCTTCAAAAAATAACACTTTTGGTTATTTAAAATAAGAAAAATAAATCATAAGCCGTTTTCTAATATCTAATTTTCATTTTAATTTT
GACCAAATTTATTTCTTATTTTTCTTATTCCAATCGCTTTTTGCTATTCGTATAGTTATCTCTAATATTAAATGGGTAATTAGGTGAACCAAATAACTGGGCCGAGTAATAATAGGTCAT
AAGAGGCTTGTTCAATTGGGCTTTCCTTTGGGTAAATGGGCCTTCCTTTGGGTTTTGATTTTATTTTTGGAAAACGACGCCGAATAGCACAATGCACAAAACAATAATATTTGTAAAAAT
AGTAATTTTTATAATCATATGGTAAACTTTTTAAAAATATTAATTATGCCCTCTCGTTTCCCTATGCTATAAATGATAGTTGTTATCACTTATAAATGTCATCGGTGATAGTTTTTAATT
TAAGAAAATTGACAAACAAAAAAAAAACATTTAAAATGGTGATTGGACGTAGGTATTTTAGTTTTTTACTGTTTTTGTGTTATATATACAATTTTTAACTTCACTAGCTTATGTTTGTTG
ATTAATTTAATTTCAGGATCTCACTCAGTCGGTCGAGTTCATTGCGTAAACTTAGTCGAAAGACTATATCCAACTGTCGATCCCACCATCGATCCAGAATATGCCAAATACCTAAAGATG
CGATGTCCAACACCAACTCCTGATCCAAACGGAGTATTGTATTCAAGAAACGACCGTGAAACTACGATGATTCTCGATAACATGTACTACAGTAACGTACTAAAACACAAAGGATTGCTC
ATAGTGGACCAAGAATTGGTTTCTAATCCTTTAACTTTACCTTACGTCAAGAAATTTGCTGCTGACAATCTCTACTTTCATGCCCAATTCTCAAGGGGCATTCGTTTGTTATCTGAGAAC
AATCCCCTCACTGGAGATCAAGGAGAGGTTAGGAAAGATTGTCGCTTTGTTAATAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCAAAACCCATTTCAGCTTTCTTCTTCTTCTTGTTCTTTTTCAGCTCTTTAATTCAGGAAGGGGCCAGTTGCAACTGAATTACTATGCAAAAAGTTGTCCAAAAGCTGAAGAG
ATTATAAAACAGCAAGTCATTGATCTTTACTATGAACATGGAAACACTGCTGTTTCGTGGCTCAGAAATCTCTTCCATGATTGCATTGTTAAG
TCTTGTGATGCGTCACTTCTGTTGGAG
ACGGTGGTGGGAGTGGAATCAGAGAAAGATTCAAGCAGAAGCTTTGGAATGAGAAATTTCAAATATGTAAATAAGATTAAAGCTGCTGTTGAGAAAGAGTGCCCTCTCACTGTTTCTTGT
GCTGACATCGTTGCTCTCTCTGCTAGAGATGGCATAGTTATG
AGGGCCTCATATAGATTTGAAAACCGGAAGAAAAGACAGCAAAATGAGTTATTCAAATATGGTTGAGGAGTTGGTTCC
ACAGCACAACGCATCTCTTGTAAATGTTCTCTCTCGTTTTAACTCCATTGGTATTGATACTGAAGCAACAGTCGCCCTTTTAG
GATCTCACTCAGTCGGTCGAGTTCATTGCGTAAACTT
AGTCGAAAGACTATATCCAACTGTCGATCCCACCATCGATCCAGAATATGCCAAATACCTAAAGATGCGATGTCCAACACCAACTCCTGATCCAAACGGAGTATTGTATTCAAGAAACGA
CCGTGAAACTACGATGATTCTCGATAACATGTACTACAGTAACGTACTAAAACACAAAGGATTGCTCATAGTGGACCAAGAATTGGTTTCTAATCCTTTAACTTTACCTTACGTCAAGAA
ATTTGCTGCTGACAATCTCTACTTTCATGCCCAATTCTCAAGGGGCATTCGTTTGTTATCTGAGAACAATCCCCTCACTGGAGATCAAGGAGAGGTTAGGAAAGATTGTCGCTTTGTTAA
TAAGTAA

Retrieve as FASTA