Entry information : CsaPrx89 (Cucsa.319800.1)
Entry ID 8856
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaPrx89 (Cucsa.319800.1)
Name (synonym) CsaPrx89 (Cucsa.319800.1)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx89
start..stop
S start..stop
EcamPrx62 375 7e-131 11..326 11..325
PpePrx68 374 1e-130 15..326 12..326
MePrx79 372 1e-129 28..325 27..323
EguPrx62 370 1e-128 11..326 11..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 488587..488817 231 N° 2 489457..489636 180 N° 3 489732..489888 157 N° 4 490586..490995 410
join(488587..488817,489457..489636,489732..489888,490586..490995)


exon

Literature and cross-references CsaPrx89 (Cucsa.319800.1)
DNA ref. Phytozome 12:   scaffold03078 (488587..490995)
Protein sequence: CsaPrx89 (Cucsa.319800.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (298)
PWM (Da):   %s   35605.27 (32576.5)  
PI (pH):   %s   6.99 (6.04) Peptide Signal:   %s   cut: 29 range:29-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPAKIPLRLRGLPTIIILLLSFSPPSFGALEEGFYKGKCGFRDVESIVGGVVTAALKRDRTLVAALLRLHFHDCFVSGCDASLLLDGSNSEKDAPPNLTVRGYDLIDAVKSQLEKTCPGIVSCADIIAMATRDAVNWAGGGRYRVETGRRDALQPANIIDLPGPSISVKDSIAVFSKRNLTVTEMVYLLGSHTVGVSHCIFFKDRLYNYKNTGGPDPTIDDQLFLNDLQTQCPEDFGDENTVFLDQNRMSSFAVDNSFHRQISRRRGILEIDQQLALDPLTKDLVLNVAFRSDFGFKFGQAMIKMGRFQVLTGSAGEIRSTCAAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGCCAAAATCCCTTTACGGCTCCGTGGACTACCCACAATAATAATTCTCCTTTTGAGCTTCTCACCACCTTCCTTTGGTGCTCTCGAGGAGGGTTTCTACAAGGGAAAATGTGGC
TTTAGAGATGTCGAGTCTATTGTTGGAGGCGTTGTCACTGCGGCACTTAAAAGAGATCGAACTCTCGTTGCTGCTCTTCTGCGTTTACACTTCCACGACTGCTTTGTCTCT
GTAACCTCT
CTTTCTCTCCATCTCCTGTGATTTTCTTTTGTGTTAATTTTAATTTATGTCTTTCAAGTTTAGGATATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAAGAGTTAATGCATAAATAATTTTCTTGTAGTTACGATCT
AATGAACAACCTGAATTAATTAACTTCAGAAATTTAATTAACAATTATAAGCTCTCACAATTAAATATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTCACAATATATATACTAGAAAGGAAATATATCCGTATACACATCTTTAAGCATCACATTATAGTC
TCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCAAATAATTACCATTGGACAATGTATTTGTGCAAAATGCGATTCAAGATACATTTAAG
TATTTTTCTAAAAATATATTATTTTGATAGGGATGTGACGCTTCCCTCCTCCTAGATGGAAGCAATAGCGAGAAGGATGCCCCTCCGAACTTGACTGTTCGAGGCTATGATCTGATTGAT
GCAGTGAAGAGTCAATTAGAGAAGACATGTCCGGGTATTGTATCTTGTGCTGATATTATCGCCATGGCTACCAGAGATGCTGTTAATTGG
GTTAGTTTGCTTCTCTTTTATCCATACACA
CAAATCTTTCTCACATACACACTGGGACTTACATTCAATCATTACTGCACTGTACTCTTTTGCAGGCTGGAGGAGGACGATACAGGGTCGAAACCGGACGACGAGATGCCTTACAACCAG
CCAACATAATTGATCTTCCGGGGCCTTCAATATCTGTCAAAGACTCAATTGCAGTCTTCTCCAAAAGAAACCTTACTGTTACAGAGATGGTTTATCTTCTTG
GTGAGTACCCCCAGCTTG
TCTACCCAACAAATTCCCATTTTTTATCATACATTTTTAGTGCAACATAGAGTTAGAGAATGGAATCTTTAGTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGATAGGATTTTC
GAACTACTAAACTTTATTAGTTGAACTATATAGGTCATTTTGACAACATTTATTCAAAATAAATTAAATGTTAAAATTGTAATCTAGGAAAATATATCAATTTTGTAAGCCTAAAATTTG
AGGTAGGTATCAATTAGAATTTCAAACCAACAATTGAATTAATTTAGTCTATCAGTCAGTAATTTCTAATTACAAAAAAAAGAGAAAAGAATGTTATGTTATGTTATTATTTCTAAATAA
ATAATGAAAAATAGTAGGAGAGGAGAACACATGAAAACAGCTCAAACTTAATGAGAACCCCGCGGCTATCGTAAATTTGATCCTCATATTTTTCTCTCCCCTAATGCACAAACCCCAAAC
GTTAGGGTGTGCGAATAATGGGTCTTCTTTTTTTTTACAGTAAAAATTTGCACAAAATTTATTAACAATGAATATGTTCTTAAGAAACAACGAAGCAATAGCTAAAGTAAAAACAATAAA
AGGCTTAATTTTCACAATAGAAAAAAAAAAGGCTTGAAGTTTATGATCACTTATGTTTGCTTGAAACAAACACAAACAGGCAGTCACACTGTTGGTGTATCACATTGCATTTTCTTCAAG
GATCGCCTGTATAATTACAAGAACACAGGGGGACCTGACCCGACCATCGATGATCAGTTGTTTCTGAACGATTTACAAACGCAATGTCCTGAAGATTTCGGCGACGAAAACACCGTATTT
CTCGACCAGAACCGTATGAGTTCTTTTGCAGTTGACAACTCGTTCCATAGGCAGATATCACGACGGAGAGGAATACTGGAAATTGATCAACAACTTGCTTTGGATCCGTTAACAAAGGAT
TTGGTGTTGAATGTGGCGTTCCGATCTGACTTCGGCTTCAAGTTTGGACAAGCAATGATCAAAATGGGAAGATTTCAAGTTCTTACTGGCTCTGCAGGGGAGATTAGAAGTACATGTGCG
GCTGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCAGCCAAAATCCCTTTACGGCTCCGTGGACTACCCACAATAATAATTCTCCTTTTGAGCTTCTCACCACCTTCCTTTGGTGCTCTCGAGGAGGGTTTCTACAAGGGAAAATGTGGC
TTTAGAGATGTCGAGTCTATTGTTGGAGGCGTTGTCACTGCGGCACTTAAAAGAGATCGAACTCTCGTTGCTGCTCTTCTGCGTTTACACTTCCACGACTGCTTTGTCTCT
GGATGTGAC
GCTTCCCTCCTCCTAGATGGAAGCAATAGCGAGAAGGATGCCCCTCCGAACTTGACTGTTCGAGGCTATGATCTGATTGATGCAGTGAAGAGTCAATTAGAGAAGACATGTCCGGGTATT
GTATCTTGTGCTGATATTATCGCCATGGCTACCAGAGATGCTGTTAATTGG
GCTGGAGGAGGACGATACAGGGTCGAAACCGGACGACGAGATGCCTTACAACCAGCCAACATAATTGAT
CTTCCGGGGCCTTCAATATCTGTCAAAGACTCAATTGCAGTCTTCTCCAAAAGAAACCTTACTGTTACAGAGATGGTTTATCTTCTTG
GCAGTCACACTGTTGGTGTATCACATTGCATT
TTCTTCAAGGATCGCCTGTATAATTACAAGAACACAGGGGGACCTGACCCGACCATCGATGATCAGTTGTTTCTGAACGATTTACAAACGCAATGTCCTGAAGATTTCGGCGACGAAAAC
ACCGTATTTCTCGACCAGAACCGTATGAGTTCTTTTGCAGTTGACAACTCGTTCCATAGGCAGATATCACGACGGAGAGGAATACTGGAAATTGATCAACAACTTGCTTTGGATCCGTTA
ACAAAGGATTTGGTGTTGAATGTGGCGTTCCGATCTGACTTCGGCTTCAAGTTTGGACAAGCAATGATCAAAATGGGAAGATTTCAAGTTCTTACTGGCTCTGCAGGGGAGATTAGAAGT
ACATGTGCGGCTGTTAAT

Retrieve as FASTA