Entry information : CsPrx41 (orange1.1g043984m/Cs7g12370)
Entry ID 8883
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-05 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx41 (orange1.1g043984m/Cs7g12370)
Name (synonym) CsPrx41 (orange1.1g043984m/Cs7g12370)
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx41
start..stop
S start..stop
CclPrx93 700 0 1..338 1..338
PtPrx92 546 0 1..338 1..341
PtPrx95 534 0 1..338 1..340
CppPrx07 530 0 22..281 1..260
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1046994..1047230 237 N° 2 1046689..1046880 192 N° 3 1046243..1046408 166 N° 4 1045668..1046086 419
complement(join(1045668..1046086,1046243..1046408,1046689..1046880,1046994..1047 230))


exon

Literature and cross-references CsPrx41 (orange1.1g043984m/Cs7g12370)
DNA ref. Citrus sinensis Annotation Project:   chr7 (8287099..8288785) Phytozome 12:   scaffold00019 (1047230..1045668)
Protein sequence: CsPrx41 (orange1.1g043984m/Cs7g12370)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (309)
PWM (Da):   %s   37479.87 (34131.0)  
PI (pH):   %s   6.23 (5.19) Peptide Signal:   %s   cut: 30 range:30-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANSLHHPRLPILQFLLLVFSSFIPRLHASEPYLTLDYYAKTCPTAFEIVRKEMECAVLSDPRNAALIVRLHFHDCFVQGCDGSVLLDDTIDLQGEKKASINRNALKGFRIIDRIKNKIESDCPGIVSCADILTIAARDAIILVGGPYWDVPVGRKDSKTASYALADSNLPSPDEGLLSIISKFHYQGLSVTDMVALSGAHTIGMARCVNYRKRIYGDYRVTSGINPLSETHLSVLKSICPPIGSDNNETAMDYETPNLFDNSFYQILLQGEGVLNSDQEMYSSIFGIQTKELVNKYAHDALAFFQQFSDSMVKMGNITNPESFVNGEVRKNCRFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAATTCTCTTCATCATCCTAGGCTTCCAATTTTGCAATTTTTGCTTTTGGTTTTCTCAAGTTTTATCCCCCGGTTGCATGCAAGTGAACCTTATTTGACGTTGGATTACTATGCA
AAGACTTGCCCGACTGCGTTCGAGATTGTGAGAAAAGAAATGGAATGTGCTGTGCTTTCGGATCCGCGCAACGCCGCCCTTATAGTCCGACTACACTTCCATGATTGCTTTGTACAG
GTT
CACATATTTAGCTGCACTGTTTGCTTAAACTAATTACGTTAAACTGTGGGTTAAGCACTCATATTAGCTAGCAGTATATTGTTGAAACTTATACAGATATGTGCATGCAGGGATGTGACG
GGTCAGTTTTACTAGACGATACTATCGACTTACAAGGAGAAAAAAAGGCTTCTATTAACAGAAACGCCCTGAAAGGTTTTAGGATTATAGACAGGATCAAGAACAAGATCGAATCCGATT
GCCCTGGAATCGTCTCTTGTGCAGATATTCTCACCATTGCTGCTAGAGACGCAATCATTCTG
GTAATATATATACAATGAAAAATTACTCTTATGCGTTATCTTTCTCTTCTCAGATTTA
GATTTAGTGCTAATCTTTTTACGAGGATGTAATTGCTGGTCATTAGATGAAGTTATATATTTAATATATTTGTATACTTTTATAAGTTCAAACATGGTATAAAATTTTTAACAGATCAGA
ACAGGTCATAAAAGCACTGAATCCAAACTCAAAGTCCTTTGTGGAACACAAAAATAATATATACGTTCATCTGTTTTGAATTGATGGAATTGTAATGTCCAGGTTGGTGGACCTTATTGG
GATGTTCCAGTGGGAAGAAAGGACTCTAAAACTGCAAGCTATGCATTAGCAGACTCGAATCTGCCCAGTCCAGATGAGGGCCTCCTCTCTATTATTTCTAAGTTTCATTATCAAGGCCTA
TCTGTCACCGATATGGTGGCTCTTTCAG
GTAAGCTACATATGATTCTCACAATAATGGGACCATTCAATGAAATCATGTCACGCGTATTTCATGTATACATTGTAATAAGAACTTATTGG
ATGAGCGCAGCATGACTTTTTTGGTTGAAACACTGCATGATTAATTTCTCAAGTGAATGCACAGGGGCTCACACCATTGGAATGGCACGCTGTGTGAATTACCGTAAGAGAATTTATGGA
GACTACAGGGTAACTTCAGGCATAAATCCATTATCCGAGACACATCTCAGCGTGTTGAAATCAATATGTCCACCCATTGGAAGTGACAATAACGAAACAGCAATGGATTATGAGACACCA
AATCTTTTCGACAATTCCTTTTACCAGATACTTCTGCAAGGAGAAGGAGTGCTGAATTCTGACCAAGAAATGTACTCGAGCATTTTCGGAATCCAAACAAAGGAGCTTGTGAATAAGTAT
GCACATGACGCTCTTGCTTTCTTCCAGCAATTCTCTGATTCGATGGTGAAGATGGGAAATATTACAAACCCGGAAAGCTTTGTCAATGGGGAAGTGAGAAAGAATTGCAGATTTGTGAAC
ACA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAATTCTCTTCATCATCCTAGGCTTCCAATTTTGCAATTTTTGCTTTTGGTTTTCTCAAGTTTTATCCCCCGGTTGCATGCAAGTGAACCTTATTTGACGTTGGATTACTATGCA
AAGACTTGCCCGACTGCGTTCGAGATTGTGAGAAAAGAAATGGAATGTGCTGTGCTTTCGGATCCGCGCAACGCCGCCCTTATAGTCCGACTACACTTCCATGATTGCTTTGTACAG
GGA
TGTGACGGGTCAGTTTTACTAGACGATACTATCGACTTACAAGGAGAAAAAAAGGCTTCTATTAACAGAAACGCCCTGAAAGGTTTTAGGATTATAGACAGGATCAAGAACAAGATCGAA
TCCGATTGCCCTGGAATCGTCTCTTGTGCAGATATTCTCACCATTGCTGCTAGAGACGCAATCATTCTG
GTTGGTGGACCTTATTGGGATGTTCCAGTGGGAAGAAAGGACTCTAAAACT
GCAAGCTATGCATTAGCAGACTCGAATCTGCCCAGTCCAGATGAGGGCCTCCTCTCTATTATTTCTAAGTTTCATTATCAAGGCCTATCTGTCACCGATATGGTGGCTCTTTCAG
GGGCT
CACACCATTGGAATGGCACGCTGTGTGAATTACCGTAAGAGAATTTATGGAGACTACAGGGTAACTTCAGGCATAAATCCATTATCCGAGACACATCTCAGCGTGTTGAAATCAATATGT
CCACCCATTGGAAGTGACAATAACGAAACAGCAATGGATTATGAGACACCAAATCTTTTCGACAATTCCTTTTACCAGATACTTCTGCAAGGAGAAGGAGTGCTGAATTCTGACCAAGAA
ATGTACTCGAGCATTTTCGGAATCCAAACAAAGGAGCTTGTGAATAAGTATGCACATGACGCTCTTGCTTTCTTCCAGCAATTCTCTGATTCGATGGTGAAGATGGGAAATATTACAAAC
CCGGAAAGCTTTGTCAATGGGGAAGTGAGAAAGAATTGCAGATTTGTGAACACA

Retrieve as FASTA